High-Performance Open-Source Archive
The goal of this package is to simplify the creation of transparent
parsers for structured text files generated by machines like laboratory
instruments. For example, we use the package to construct parsers for
files generated by plate readers. The
data generated by these instruments can usually be exported to text or
spreadsheet files. Such files consist of lines of text organized in
higher-order structures like headers with metadata and blocks of
measured values, etc.. It’s often convenient to analyze the
data in a program like R. To be able to do that you have to have a
parser that processes these files and creates R-objects as output. The
parcrpackage simplifies the task of creating such
parsers.
The parsers that are created with this package make extensive use of functional programming. If this topic is new to you then please read about Functional Programming, in particular the chapters Function Factories and Function Operators, in Hadley Wickham’s book Advanced R.
The parcr package contains a set of functions that allow
you to create simple parsers with higher order functions, functions that
can take functions as input and have functions as output. These are
sometimes called combinators. The ideas behind the package are described
in a paper by Hutton (1992). A number of
the functions described in this paper are implemented with modifications
in the current package. The package was also heavily inspired by the Ramble
package which is written in the same vein, but without the explicit
parsing of structured text files in mind.
listThe parsers constructed with the functions from this package generate
a list as an output. The parsers read the input vector from
left to right. When the parser fails the output will be the empty list
list(). However, if the parser is successful then it
produces a list with two elements. An element called
L (the left part) contains the output generated by
that part of the input vector which was successfully parsed, and the
element called R (the right part) which contains
the remainder that was not parsed. When an entire character vector is
parsed the content of the R element equals
character(0). The content of the L part can be
shaped to your desire. This is demonstrated in the example of the
fasta file parser later in this document.
Please realize that every function described below is a higher order
function: their output is a function. In its turn, this function can
take a character vector as its input. For example,
literal("a") yields a function. To use that function as a
parser you have to provide it with a character vector, the object that
needs to be parsed, as input:
literal("a")(c("a","att"))
This parser tests whether the next element in its input is literally
the string “a”. It will succeed in the example above, but will only
consume the first element of its input and then stop. However, you can
also use a higher order function like literal("a") as input
to other higher order functions to create more complex parsers. For
example, the function then takes two parsers
p1 and p2 as arguments,
then(p1, p2) and applies them in sequence to the input. In
the parcr package the function is implemented in the infix
form %then% which makes parser constructs better readable.
The composite parser:
literal("a") %then% literal("att")
looks for an element with string “a” followed by an element with string “att”. Its application to the same vector:
(literal("a") %then% literal("att"))(c("a","att"))
will completely consume the input. In this way, using a number of standard parsers defined in the package, you can quickly construct flexible parsers taking complex input. Furthermore, the functions also allow you to construct a desired R object as output while parsing.
parcr packageWe will now discuss all of the parser combinator functions present in the package. You should also study their help pages. In particular the Pseudocode listed for each of them should help you to understand their properties.
The six fundamental parsers allow you to construct a parser that will completely consume input, or to fail when the input does not satisfy the specifications of the parser.
succeed(o): where o is any kind of
R-objectfail()The succeed and fail parsers are the nuts
and bolts of a parser construction. The succeed parser
always succeeds, without consuming any input, whereas the
fail parser always fails.
The succeed parser constructs a list object
with a ‘left’ or L-element that contains the parsed result
of the consumed part of the input vector and the ‘right’ or
R-element that contains the unconsumed part of the vector.
The L-element can contain any R-object that is constructed
during parsing.
While succeed never fails, fail always
does, regardless of the input vector. To signal failure it returns a
special form of the empty list list(), namely a
marker object printed as the icon [].
Important: It is unlikely that you will ever use these two functions to construct parsers.
Examples:
The basic functions for recognizing the content of the current element, the left-most element of the input vector.
literal(c): tests whether the current element equals
the string c.satisfy(b): tests whether the current element satisfies
function b() where b() is a logical function:
it takes a string as input and returns TRUE or
FALSE.eof() : tests whether the input is at its end.eof() is a special function that detects the end of a
character vector, or if that character vector represents the lines of
text file, the end of the file (EOF). In fact, it detects
character(0) in the input vector and when successful it
turns the R-side of the output into an empty list
(list()) to signal that the end of the vector was
detected.
Examples:
starts_with_a <- function(x) {grepl("^a", x)}
satisfy(starts_with_a)(c('abc','def'))
#> $L
#> $L[[1]]
#> [1] "abc"
#>
#>
#> $R
#> [1] "def"And here is an example of an unsuccessful parser:
An application of eof() to detect that we parsed the
input completely.
(literal("a") %then% literal("att") %then% eof())(c("a","att"))
#> $L
#> $L[[1]]
#> [1] "a"
#>
#> $L[[2]]
#> [1] "att"
#>
#>
#> $R
#> list()Notice how the R-element differs from just
p1 %or% p2: applies alternative parsers p1
and p2 on the current element and returns the result of the
first successful parser, or failure when both fail.p1 %then% p2: applies parser p1 on the
current element and p2 on the next element.The %or% combinator enables us to try alternative
parsers on the current element, whereas the %then%
combinator enables us to test sequences of elements in a character
vector.
Note that %or% uses lazy evaluation which means that the
output of %or% depends on the order of p1 and
p2: if both would in principle succeed then only the result
of p1 is returned.
We also have two variations of the %then% combinator,
%xthen% and %thenx% which do test but then
discard the result from the first or second argument:
p1 %xthen% p2: where p1 and
p2 are parsers discards the result from
p2p1 %thenx% p2: where p1 and
p2 are parsers discards the result from
p1Examples:
(literal('A') %or% satisfy(starts_with_a))(c('abc','def'))
#> $L
#> $L[[1]]
#> [1] "abc"
#>
#>
#> $R
#> [1] "def"As said, the six fundamental parsers allow you to construct a parser that will completely consume input. However, when this parser succeeds its output will, apart from the fact that every element is put in a list, be equal to the input. In general, this is not very useful if you want to use the output in other code. Therefore, we have two functions that allow you to modify the output of successful parser. The basic functions for modifying output of a parser are:
p %ret% c : when parser p is successful it
returns the object c (a string or NULL).p %using% f : when parser p is successful
function f() is applied to the input and its output is
stored as the result.Examples
Derived parsers are constructed from the six fundamental parsers.
zero_or_one(p): where p is a parser.zero_or_more(p): where p is a parser.one_or_more(p): where p is a parser.exactly(n,p): where n is an integer and
p is a parser.match_n(n,p): where n is an integer and
p is a parser.zero_or_one, zero_or_more and
one_or_more do exactly what their names suggest. You should
realize that these are greedy parsers: they consume as many as possible
strings that can be successfully parsed by p. Similarly,
exactly is a greedy parser, and it fails when there are
less or more than n consecutive strings that can be
successfully parsed by p. On the other hand
match_n is not greedy. It consumes n but no
more strings that can be successfully parsed with p.
Examples:
This parser will fail on its input, too many strings starting with “a”:
The following is a successful parse. Note that its result is not
merely [] which would have indicated failure, but an
L,R-list with an empty list in the
L-element.
zero_or_more(satisfy(starts_with_a))(c('cat','gac','cct'))
#> $L
#> list()
#>
#> $R
#> [1] "cat" "gac" "cct"one_or_more(satisfy(starts_with_a))(c('att','aac','cct'))
#> $L
#> $L[[1]]
#> [1] "att"
#>
#> $L[[2]]
#> [1] "aac"
#>
#>
#> $R
#> [1] "cct"match_sWhen constructing a parser you will often need to recognize as well
as process strings. For example, you want to recognize multiple integers
in a line, extract these and then return them as a numeric vector.
You’re not interested in other elements like comments in these strings.
This could be achieved by combining satisfy() and
subsequently %using%, like:
satisfy(has_integers) %using% process_integers
where has_integers is a boolean function and
process_integers is a function that both recognizes ,
extracts and rearranges numbers to a numeric vector. You will often find
that has_integers and process_integers use the
same regular expressions. Then it may be more efficient to combine
these, which is what the match_s() function does.
The match_s() parser takes a simple (not higher-order)
function s to process the string from the current element
and returns the result from that function. The function s
has to be constructed in such a way that it returns the empty
list() when the string does not satisfy the criteria that
the user sets.
Example:
Here numbers is a function hat recognizes and returns
numbers (in fact, positive integers) in a string:
numbers <- function(x) {
m <- gregexpr("[[:digit:]]+", x)
matches <- as.numeric(regmatches(x,m)[[1]])
if (length(matches)==0) {
return(list()) # we signal parser failure when no numbers were found
} else {
return(matches)
}
}
match_s(numbers)(" 101 12 187 # a comment on these numbers")
#> $L
#> $L[[1]]
#> [1] 101 12 187
#>
#>
#> $R
#> character(0)by_split(p, split, finish = TRUE, fixed = FALSE, perl = FALSE):
where p is a parserby_symbol(p, finish = TRUE): where p is a
parserAlthough you can use the string processing functions from the
base or stringr packages to parse and process
individual elements of a character vector it is also possible to parse
substrings by first splitting a string. by_split uses a
split pattern to first split the incoming string and then
applies the parser p to it. by_symbol splits
the incoming string to individual symbols and then applies the parser
p. The finish boolean indicates whether the
parser should completely consume the split string.
Under the hood these functions use the function
strsplit() and its split, fixed
and perl arguments are passed on.
Examples:
starts_with_a <- function(x) grepl("^a",x[1])
# don's forget to use satisfy(), it turns starts_with into a parser
by_split(one_or_more(satisfy(starts_with_a)), ",", fixed = TRUE)("atggc,acggg,acttg")
#> $L
#> $L[[1]]
#> [1] "atggc"
#>
#> $L[[2]]
#> [1] "acggg"
#>
#> $L[[3]]
#> [1] "acttg"
#>
#>
#> $R
#> character(0)by_symbol(literal(">") %thenx% one_or_more(literal("b")), finish = FALSE)(">bb")
#> $L
#> $L[[1]]
#> [1] "b"
#>
#> $L[[2]]
#> [1] "b"
#>
#>
#> $R
#> character(0)Note: Parsers become slow when
using these two functions extensively. If that bothers you then you
should use the match_s or satisfy()and
%using% parsers together with string processing functions
like grepl and grep or the ones from
stringr to process strings. Those parsers will be much
faster.
EmptyLine()Spacer()MaybeEmpty()The function EmptyLine() detects and returns empty line.
Empty lines are either the string "" or strings consisting
entirely of space-like characters as identified by the regular
expression \\s. Spacer() detects one or more
consecutive empty lines and discards these whereas
MaybeEmpty() detects zero or more empty lines and discards
these.
An additional function Ignore() ignores all lines,
whether empty or not, until the end of the file. This is sometimes
useful when the interesting part of a file has been parsed and all else
can be ignored until the end of the file.
Note that I write these functions with capital letters. I use this convention here and in the example below to indicate that these functions parse higher-order structures (higher than the individual strings) in the input.
Examples:
As an example of a somewhat realistic application let’s try to write a parser for fasta-formatted files for mixed nucleotide and protein sequences.
Such a fasta file could look like the example below
>sequence_A
GGTAAGTCCTCTAGTACAAACACCCCCAAT
TCTGTTGCCAGAAAAAACACTTTTAGGCTA
>sequence_B
ATTGTGATATAATTAAAATTATATTCATAT
TATTAGAGCCATCTTCTTTGAAGCGTTGTC
TATGCATCGATC
>sequence_C
MTEITAAMVKELRESTGAGMMDCKNALSET
NGDFDKAVQLLREKGLGKAAKKADRLAAEG
ENEYKALVAELEKE
where the first two are nucleotide sequences and the last is a protein sequence1.
Since fasta files are text files we could read such a file using
readLines(). Below we simulate the result of reading the
file above by loading the nuclfasta and
protfasta data sets present in the package. The consist of
character vectors.
We can distinguish the following higher order components in a fasta file:
{G,A,T,C}.{A,R,N,D,B,C,E,Q,Z,G,H,I,L,K,M,F,P,S,T,W,Y,V}.It now becomes clear what I mean when I say that the package allows
us to write transparent parsers: the description above of the structure
of fasta files can be translated straight into code for a
Fasta() parser:
Fasta <- function() {
one_or_more(SequenceBlock()) %then%
eof()
}
SequenceBlock <- function() {
MaybeEmpty() %then%
Header() %then%
(NuclSequence() %or% ProtSequence())
}
NuclSequence <- function() {
one_or_more(NuclSequenceString())
}
ProtSequence <- function() {
one_or_more(ProtSequenceString())
}Notice that these elements are functions taking no input, hence the
empty argument brackets () behind their names. They can
take input when needed, for example to change their behavior (like
match_n(), or see the other example below).
Now we need to define the string-parsers Header(),
NuclSequenceString() and ProtSequenceString()
that recognize and process these elements in the character vector
fastafile. We use functions from stringr to do
this in three helper functions, and we use match_s() to
create parsers from these.
# returns the title after the ">" in the sequence header
parse_header <- function(line) {
# Study stringr::str_match() to understand what we do here
m <- stringr::str_match(line, "^>(\\w+)")
if (is.na(m[1])) {
return(list()) # signal failure: no title found
} else {
return(m[2])
}
}
# returns a nucleotide sequence string
parse_nucl_sequence_line <- function(line) {
# The line must consist of GATC from the start (^) until the end ($)
m <- stringr::str_match(line, "^([GATC]+)$")
if (is.na(m[1])) {
return(list()) # signal failure: not a valid nucleotide sequence string
} else {
return(m[2])
}
}
# returns a protein sequence string
parse_prot_sequence_line <- function(line) {
# The line must consist of ARNDBCEQZGHILKMFPSTWYV from the start (^) until the
# end ($)
m <- stringr::str_match(line, "^([ARNDBCEQZGHILKMFPSTWYV]+)$")
if (is.na(m[1])) {
return(list()) # signal failure: not a valid protein sequence string
} else {
return(m[2])
}
}Then we define the parsers.
Header <- function() {
match_s(parse_header)
}
NuclSequenceString <- function() {
match_s(parse_nucl_sequence_line)
}
ProtSequenceString <- function() {
match_s(parse_prot_sequence_line)
}Now we have all the elements that we need to apply the
Fasta() parser.
Fasta()(fastafile)
#> $L
#> $L[[1]]
#> [1] "sequence_A"
#>
#> $L[[2]]
#> [1] "GGTAAGTCCTCTAGTACAAACACCCCCAAT"
#>
#> $L[[3]]
#> [1] "TCTGTTGCCAGAAAAAACACTTTTAGGCTA"
#>
#> $L[[4]]
#> [1] "sequence_B"
#>
#> $L[[5]]
#> [1] "ATTGTGATATAATTAAAATTATATTCATAT"
#>
#> $L[[6]]
#> [1] "TATTAGAGCCATCTTCTTTGAAGCGTTGTC"
#>
#> $L[[7]]
#> [1] "TATGCATCGATC"
#>
#> $L[[8]]
#> [1] "sequence_C"
#>
#> $L[[9]]
#> [1] "MTEITAAMVKELRESTGAGMMDCKNALSET"
#>
#> $L[[10]]
#> [1] "NGDFDKAVQLLREKGLGKAAKKADRLAAEG"
#>
#> $L[[11]]
#> [1] "ENEYKALVAELEKE"
#>
#>
#> $R
#> list()Apart from match_s(), we have used only the six
fundamental parsers. Therefore, the output is almost the same as the
parsed input. This is not very useful because it is difficult to extract
the individual sequences and titles from it; we would have to write sort
of parser again to process this output. To mend this, we have to modify
the output of the parsers. The first thing that we will do is to let
every sequence block be returned as an element of a list. To achieve
this we extend the SequenceBlock parser by changing its
output with the %using% operator:
SequenceBlock <- function() {
MaybeEmpty() %then%
Header() %then%
(NuclSequence() %or% ProtSequence()) %using%
function(x) list(x)
}Now the result is a list of three lists, one for each sequence block.
Fasta()(fastafile)[["L"]]
#> [[1]]
#> [[1]][[1]]
#> [1] "sequence_A"
#>
#> [[1]][[2]]
#> [1] "GGTAAGTCCTCTAGTACAAACACCCCCAAT"
#>
#> [[1]][[3]]
#> [1] "TCTGTTGCCAGAAAAAACACTTTTAGGCTA"
#>
#>
#> [[2]]
#> [[2]][[1]]
#> [1] "sequence_B"
#>
#> [[2]][[2]]
#> [1] "ATTGTGATATAATTAAAATTATATTCATAT"
#>
#> [[2]][[3]]
#> [1] "TATTAGAGCCATCTTCTTTGAAGCGTTGTC"
#>
#> [[2]][[4]]
#> [1] "TATGCATCGATC"
#>
#>
#> [[3]]
#> [[3]][[1]]
#> [1] "sequence_C"
#>
#> [[3]][[2]]
#> [1] "MTEITAAMVKELRESTGAGMMDCKNALSET"
#>
#> [[3]][[3]]
#> [1] "NGDFDKAVQLLREKGLGKAAKKADRLAAEG"
#>
#> [[3]][[4]]
#> [1] "ENEYKALVAELEKE"In principle, this output is easier to extract information from, but
we can improve on it. First, we want the sequences to appear as one long
string, not as separate character vectors corresponding to the lines in
the sequence block. Therefore, we extend the NuclSequence
and ProtSequence parsers collapsing their output:
NuclSequence <- function() {
one_or_more(NuclSequenceString()) %using%
function(x) paste0(x, collapse = "")
}
ProtSequence <- function() {
one_or_more(ProtSequenceString()) %using%
function(x) paste0(x, collapse="")
}Then we get
Fasta()(fastafile)[["L"]]
#> [[1]]
#> [[1]][[1]]
#> [1] "sequence_A"
#>
#> [[1]][[2]]
#> [1] "GGTAAGTCCTCTAGTACAAACACCCCCAATTCTGTTGCCAGAAAAAACACTTTTAGGCTA"
#>
#>
#> [[2]]
#> [[2]][[1]]
#> [1] "sequence_B"
#>
#> [[2]][[2]]
#> [1] "ATTGTGATATAATTAAAATTATATTCATATTATTAGAGCCATCTTCTTTGAAGCGTTGTCTATGCATCGATC"
#>
#>
#> [[3]]
#> [[3]][[1]]
#> [1] "sequence_C"
#>
#> [[3]][[2]]
#> [1] "MTEITAAMVKELRESTGAGMMDCKNALSETNGDFDKAVQLLREKGLGKAAKKADRLAAEGENEYKALVAELEKE"This looks much better: we know that the first element in each of
these lists is the title and the second element is the complete
sequence. Then why not just attach a name to these elements? This would
make extracting the information even easier. Furthermore, we also report
whether the sequence is a nucleotide or a protein sequence by adding a
type tag.
Header <- function() {
match_s(parse_header) %using%
function(x) list(title = unlist(x))
}
NuclSequence <- function() {
one_or_more(NuclSequenceString()) %using%
function(x) list(type = "Nucl", sequence = paste0(x, collapse=""))
}
ProtSequence <- function() {
one_or_more(ProtSequenceString()) %using%
function(x) list(type = "Prot", sequence = paste0(x, collapse=""))
}Finally, we have our desired output.
d <- Fasta()(fastafile)[["L"]]
d
#> [[1]]
#> [[1]]$title
#> [1] "sequence_A"
#>
#> [[1]]$type
#> [1] "Nucl"
#>
#> [[1]]$sequence
#> [1] "GGTAAGTCCTCTAGTACAAACACCCCCAATTCTGTTGCCAGAAAAAACACTTTTAGGCTA"
#>
#>
#> [[2]]
#> [[2]]$title
#> [1] "sequence_B"
#>
#> [[2]]$type
#> [1] "Nucl"
#>
#> [[2]]$sequence
#> [1] "ATTGTGATATAATTAAAATTATATTCATATTATTAGAGCCATCTTCTTTGAAGCGTTGTCTATGCATCGATC"
#>
#>
#> [[3]]
#> [[3]]$title
#> [1] "sequence_C"
#>
#> [[3]]$type
#> [1] "Prot"
#>
#> [[3]]$sequence
#> [1] "MTEITAAMVKELRESTGAGMMDCKNALSETNGDFDKAVQLLREKGLGKAAKKADRLAAEGENEYKALVAELEKE"Let’s present the result more concisely using the names of these elements:
invisible(lapply(d, function(x) {cat(x$type, x$title, x$sequence, "\n")}))
#> Nucl sequence_A GGTAAGTCCTCTAGTACAAACACCCCCAATTCTGTTGCCAGAAAAAACACTTTTAGGCTA
#> Nucl sequence_B ATTGTGATATAATTAAAATTATATTCATATTATTAGAGCCATCTTCTTTGAAGCGTTGTCTATGCATCGATC
#> Prot sequence_C MTEITAAMVKELRESTGAGMMDCKNALSETNGDFDKAVQLLREKGLGKAAKKADRLAAEGENEYKALVAELEKEIn the examples above we showed how to create parsers without parameters. It is easy and useful to sometimes create parsers with parameters. The parameters are used to change the behavior of the parsers. For example, when writing online course material I use a simple structured question template that is converted to html when the syllabus is generated. It consists mostly of markdown content. Its parser makes use of parametrized parsers. The structure of such a question template document is as follows3:
#### INTRO
## Title about a set of questions
This is optional introductory text to a set of questions.
Titles preceded by four hashes are not allowed in a question template.
#### QUESTION
This is the first question
#### TIP
This would be a tip. tips are optional, and multiple tips can be given. Tips are
wrapped in hide-reveal style html elements.
#### TIP
This would be a second tip.
#### ANSWER
The answer to the question is optional and is wrapped in a hide-reveal html element.
#### QUESTION
This is the second question. No tips for this one
#### ANSWER
Answer to the second question
<optionally more questions>
I stored this example content in a vector qtemp to parse
it later.
You notice the recurring structure of a header with four hashes
#### and some text following it. These headers represent
four types of elements: intro, question, tip and answer. Instead of
writing separate parsers we could create a generic parser for such
elements as:
HeaderAndContent <- function(type) {
(Header(type) %then% Content()) %using%
function(x) list(list(type=type, content=unlist(x)))
}Then we define each of the four parsers as:
Intro <- function() HeaderAndContent("intro")
Question <- function() HeaderAndContent("question")
Tip <- function() HeaderAndContent("tip")
Answer <- function() HeaderAndContent("answer")The function Header(type) is defined as
Header <- function(type) satisfy(header(type)) %ret% NULL
# This must also be a generic function: a function that generates a function to
# recognize a header of type 'type'
header <- function(type) {
function(x) grepl(paste0("^####\\s+", toupper(type), "\\s*"), x)
}The content consists of one or more lines not starting with
####, which includes empty lines. We discard trailing empty
lines.
Content <- function() {
(one_or_more(match_s(content))) %using%
function(x) stringr::str_trim(paste0(x,collapse="\n"), "right")
}
content <- function(x) {
if (grepl("^####", x)) list()
else x
}The complete template is defined as follows
where QuestionBlock() is defined using the previously
defined elements as
Basic error messaging is implemented in the function
reporter(). You can wrap a parser in the
reporter() function to obtain an error message that reports
the line of the input in which the parser ultimately failed as well as
some lines around it to provide context. Here is an example:
TenAs <- function() {
exactly(10, literal("A")) %then% eof()
}
TenAs()(c(rep("A",5),"B",rep("A",3)))
#> []This output is not very useful for debugging, so we wrap the parser
in the reporter() function and then apply it to the input
(and, since we obtaina a system error we also wrap it in a
try() statement):
try(reporter(TenAs())(c(rep("A",5),"B",rep("A",3))))
#> Error : Parser failed on line 6 of input.
#> 4 | A
#> 5 | A
#> 6 | >> B
#> 7 | A
#> 8 | AHowever, we might want to have more information on why there is an error on that line. Or, we would like the parser to report what it expected.
A few basic parsers now automatically report such an expectation. The
literal() parser knows exactly what it should get and
therefore, by default reports ‘literal “[x]”’ where [x] is the literal
value.
parser <- literal("START") %then% literal("END")
try(reporter(parser)(c("BEGIN","END")))
#> Error : Parser failed on line 1 of input.
#> Expected: literal 'START'
#> 1 | >> BEGIN
#> 2 | ENDSimilarly, eof() expects an end of file signal and
reports it if it was not encountered:
You can provide custom descriptions when using
satisfy():
named()The named() function can be used to upgrade custom
parser to one with an intelligible error message. Here is an example
with the fasta file with a bad header.
bad_header <- c(
"*sequence_A",
"GGTAAGTCCTCTAGTACAAACACCCCCAAT",
">sequence_B",
"ATTGTGATATAATTAAAATTATATTCATAT"
)We upgrade the Fasta() parser to a named parser:
Header <- function() {
named(
match_s(stringparser("^>(\\w+)")) %using%
function(x) list(title = unlist(x)),
"FASTA header (>sequence_name)"
)
}where the first argument to the named() function is a
parser body and the second argument is a brief description of the
parser. Now, the reporter yields a more detailed message:
try(reporter(Fasta())(bad_header))
#> Error : Parser failed on line 1 of input.
#> Expected: FASTA header (>sequence_name)
#> 1 | >> *sequence_A
#> 2 | GGTAAGTCCTCTAGTACAAACACCCCCAAT
#> 3 | >sequence_B
#> 4 | ATTGTGATATAATTAAAATTATATTCATATWhen using %or%, the error message shows all valid
alternatives. Here we demonstrate this with the
SequenceBlock() parser which contains the expression
NuclSequence() %or% ProtSequence(). We upgrade both
alternative parsers:
NuclSequence <- function() {
named(
one_or_more(NuclSequenceString()) %using%
function(x) list(type = "Nucl", sequence = paste0(x, collapse="")),
"Nucleotide sequence"
)
}
ProtSequence <- function() {
named(
one_or_more(ProtSequenceString()) %using%
function(x) list(type = "Prot", sequence = paste0(x, collapse="")),
"Protein sequence"
)
}
missing_sequence <- c(
">sequence_A",
">sequence_B",
"ATTGTGATATAATTAAAATTATATTCATAT"
)
try(reporter(Fasta())(missing_sequence))
#> Error : Parser failed on line 2 of input.
#> Expected one of: Nucleotide sequence, Protein sequence
#> 1 | >sequence_A
#> 2 | >> >sequence_B
#> 3 | ATTGTGATATAATTAAAATTATATTCATATIt is not clear to me whether mixing of sequence types is allowed in the fasta format. I guess not, because a protein sequence consisting entirely of glutamate (G), alanine (A), threonine (T) and cysteine (C) would not be distinguishable from a nucleotide sequence. Such protein sequences would be extremely rare. Anyway I demonstrate here that apart from this ambiguous case it is easy to parse them from a single file.↩︎
Note that real fasta headers and sequences can have more complicated formats than I pretend here.↩︎
I simplified the template and code for this example. In
fact the content is processed differently depending on the type of
element, meaning that Content() is a function of
type. Furthermore, questions are automatically numbered.↩︎
Need mirroring services?
Contact our team at info@vpspulse.com.
Mirror powered by VPSpulse
Infrastructure sponsored by VPSPulse & Secure Payments by ArionPay.