VPSPulse Mirrors

High-Performance Open-Source Archive

Help for package astsa

Package {astsa}


Type: Package
Title: Applied Statistical Time Series Analysis
Version: 2.5
Date: 2026-03-113
Depends: R (≥ 3.5)
Author: David Stoffer [aut, cre], Nicky Poison [ctb, mus, spy]
Maintainer: David Stoffer <stoffer@pitt.edu>
BugReports: https://github.com/nickpoison/astsa/issues
Description: Contains data sets and scripts for analyzing time series in both the frequency and time domains including state space modeling as well as supporting the texts Time Series Analysis and Its Applications: With R Examples (5th ed), by R.H. Shumway and D.S. Stoffer. Springer Texts in Statistics, 2025, <doi:10.1007/978-3-031-70584-7>, and Time Series: A Data Analysis Approach Using R (2nd ed). Chapman-Hall, 2026, https://www.routledge.com/Time-Series-A-Data-Analysis-Approach-Using-R/Shumway-Stoffer/p/book/9781041031642. Most scripts are designed to require minimal input to produce aesthetically pleasing output for ease of use in live demonstrations and course work.
URL: https://dsstoffer.github.io/, https://nickpoison.github.io/
License: GPL-2 | GPL-3 [expanded from: GPL (≥ 2)]
LazyLoad: yes
LazyData: yes
NeedsCompilation: no
Packaged: 2026-03-11 01:57:34 UTC; dss
Repository: CRAN
Date/Publication: 2026-03-11 09:20:08 UTC

Applied Statistical Time Series Analysis (more than just data)

Description

Contains data sets and scripts for analyzing time series in both the frequency and time domains including state space modeling as well as supporting the texts Time Series Analysis and Its Applications: With R Examples (5th ed, 2025) and Time Series: A Data Analysis Approach Using R, (2nd ed, 2026). Most scripts are designed to need minimal input to produce aesthetically pleasing output for ease of use in live demonstrations and in course work.

Details

Package: astsa
Type: Package
Version: 2.5
Date: 2026-03-13
License: GPL (>= 2)
LazyLoad: yes
LazyData: yes

Warning

If the package dplyr is loaded, it will mask the base scripts filter and lag (among other things) that a time series analyst uses often. In this case, whenever you analyze time series data, we suggest you either:

(1) Detach it if it's loaded but not being used:

   detach(package:dplyr)

(2) If you want to use it, fix it:

   library(dplyr, exclude = c("filter", "lag"))   # load it without the culprits 
   dlag    = dplyr::lag         # and fix ... 
   dfilter = dplyr::filter      # ... the blunders

then use dlag and dfilter for dplyr scripts
and lag and filter can be use as originally intended.

(3) Or just take back the commands:

   filter = stats::filter
   lag    = stats::lag 

and you can still use these for dpylr:

   dlag    = dplyr::lag
   dfilter = dplyr::filter

(4) Or avoid all of these problems and use data.table instead of dplyr. If you are doing data manipulation, you should know that dplyr is inspired by data.table, but it is much slower and weaker than data.table.

Author(s)

David Stoffer <stoffer@pitt.edu>

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Convert ARMA Process to Infinite AR Process

Description

Gives the \pi-weights in the invertible representation of an ARMA model.

Usage

ARMAtoAR(ar = 0, ma = 0, lag.max=20)

Arguments

ar

vector of AR coefficients

ma

vector of MA coefficients

lag.max

number of pi-weights desired

Value

A vector of coefficients. For an ARMA model \phi(B) x_t = \theta(B) w_t, returns the coefficients \{\pi_j; \, j=1, 2, ...\} in the invertible representation w_t = \pi(B) x_t = \sum_{j=0}^\infty \pi_j x_{t-j} where \pi_0=1.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

ARMAtoAR(ar=.9, ma=.5, 10)

Daily Returns of Three Banks

Description

Daily returns of three banks, 1. Bank of America [boa], 2. Citibank [citi], and 3. JP Morgan Chase [jpm], from 2005 to 2017.

Format

The format is: Time-Series [1:3243, 1:3] from 2005 to 2017: -0.01378 -0.01157 -0.00155 -0.01084 0.01252 ... with column names "boa" "citi" "jpm" .

Source

Gong & Stoffer (2021). A Note on Efficient Fitting of Stochastic Volatility Models. Journal of Time Series Analysis, 42(2), 186-200.

https://github.com/nickpoison/Stochastic-Volatility-Models

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

tsplot(BCJ, col=2:4)

Entire Epstein-Barr Virus (EBV) Nucleotide Sequence

Description

EBV nucleotide sequence - 172281 bp as a single string

Format

The format is: chr "AGAATTCGTCTT ..."

Note

EBV is not useful on its own, but using 'dna2vector', different regions can be explored. For example, ebv = dna2vector(EBV)

Source

https://www.ncbi.nlm.nih.gov/nuccore/V01555.2

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

dna2vector

Examples


substr(EBV, start=1, stop=25)
head(dna2vector(EBV))

EM Algorithm for State Space Models

Description

Estimation of the parameters in general linear state space models via the EM algorithm. Missing data may be entered as NA or as zero (0), however, use NAs if zero (0) can be an observation. Inputs in both the state and observation equations are allowed. This script replaces EM0 and EM1.

Usage

EM(y, A, mu0, Sigma0, Phi, Q, R, Ups = NULL, Gam = NULL, input = NULL, 
    max.iter = 100, tol = 1e-04)

Arguments

y

data matrix (n x q), vector or time series, n = number of observations, q = number of series. Use NA or zero (0) for missing data, however, use NAs if zero (0) can be an observation.

A

measurement matrices; can be constant or an array with dimension dim=c(q,p,n) if time varying. Use NA or zero (0) for missing data.

mu0

initial state mean vector (p x 1)

Sigma0

initial state covariance matrix (p x p)

Phi

state transition matrix (p x p)

Q

state error matrix (p x p)

R

observation error matrix (q x q - diagonal only)

Ups

state input matrix (p x r); leave as NULL (default) if not needed

Gam

observation input matrix (q x r); leave as NULL (default) if not needed

input

NULL (default) if not needed or a matrix (n x r) of inputs having the same row dimension (n) as y

max.iter

maximum number of iterations

tol

relative tolerance for determining convergence

Details

This script replaces EM0 and EM1 by combining all cases and allowing inputs in the state and observation equations. It uses version 1 of the new Ksmooth script (hence correlated errors is not allowed).

The states x_t are p-dimensional, the data y_t are q-dimensional, and the inputs u_t are r-dimensional for t=1, \dots, n. The initial state is x_0 \sim N(\mu_0, \Sigma_0).

The general model is

x_t = \Phi x_{t-1} + \Upsilon u_{t} + w_t \quad w_t \sim iid\ N(0, Q)

y_t = A_t x_{t-1} + \Gamma u_{t} + v_t \quad v_t \sim iid\ N(0, R)

where w_t \perp v_t. The observation noise covariance matrix is assumed to be diagonal and it is forced to diagonal otherwise.

The measurement matrices A_t can be constant or time varying. If time varying, they should be entered as an array of dimension dim = c(q,p,n). Otherwise, just enter the constant value making sure it has the appropriate q \times p dimension.

Value

Phi

Estimate of Phi

Q

Estimate of Q

R

Estimate of R

Ups

Estimate of Upsilon (NULL if not used)

Gam

Estimate of Gamma (NULL if not used)

mu0

Estimate of initial state mean

Sigma0

Estimate of initial state covariance matrix

like

-log likelihood at each iteration

niter

number of iterations to convergence

cvg

relative tolerance at convergence

Note

The script does not allow for constrained estimation directly, however, constrained estimation is possible with some extra manipulations. There is an example of constrained estimation using EM at FUN WITH ASTSA, where the fun never stops.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

Kfilter, Ksmooth

Examples

y = ar1miss   # an 'astsa' data set with missing values
A = 1; Phi = .1; Ups = 1
Q = 0.1; R = 0.1; Gam=1
mu0 = 0; Sigma0 = 1
input = rep(1, length(y))
( em = EM(y, A, mu0, Sigma0, Phi, Q, R, Ups, Gam, input) ) 

# run Kalman smoother at the final estimates
ks = Ksmooth(y, A=1, em$mu0, em$Sigma0, em$Phi, sQ=sqrt(em$Q), sR=sqrt(em$R),
              Ups=em$Ups, Gam=em$Gam, input=input) 

# admire your work
tsplot(cbind(y, drop(ks$Xs)), type='o', pch=c(19,NA), col=2*2:3, lwd=1:2, 
        gg=TRUE, spag=TRUE, addLegend=TRUE, legend=c('data', 'smooth'))
miss = cbind(which(is.na(y)), min(y, na.rm=TRUE)-.2)   # show yourself
points(miss, pch=18)

El Nino - Southern Oscillation Index

Description

Southern Oscillation Index (SOI), 1/1951 to 10/2022; anomalies are departures from the 1981-2010 base period.

Format

The format is: Time-Series [1:862] from 1951 to 2022: 2.0 1.1 -0.3 -0.8 -1.1 -0.7 -1.5 -0.3 -0.7 -0.7 ...

Details

The \textrm{El Ni\~no - Southern Oscillation (ENSO)} is a recurring climate pattern involving changes in the temperature of waters in the central and eastern tropical Pacific Ocean. This data set is an update to soi.

Source

https://www.ncei.noaa.gov/access/monitoring/enso/soi

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

soi, ENSO, MEI, MEI2

Examples

# ENSO is a standardized index based on the sea level pressure differences between 
# Tahiti and Darwin, Australia.  MEI is a similar index based on multiple factors.
# As opposed to ENSO (and SOI), positive values of MEI correspond to warmer temperatures.

tsplot(cbind(-ENSO, MEI), col=astsa.col(2*2:1, .6), addLegend=TRUE, spag=TRUE, lwd=1:2)

tspairs(ts.intersect(-ENSO, MEI), location='top')


Seismic Trace of Earthquake number 5

Description

Seismic trace of an earthquake [two phases or arrivals along the surface, the primary wave (t = 1,\dots,1024) and the shear wave (t = 1025,\dots,2048)] recorded at a seismic station.

Format

The format is: Time-Series [1:2048] from 1 to 2048: 0.01749 0.01139 0.01512 0.01477 0.00651 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

eqexp


Earthquake Counts

Description

Series of annual counts of major earthquakes (magnitude 7 and above) in the world between 1900 and 2006.

Format

The format is: Time-Series [1:107] from 1900 to 2006: 13 14 8 10 16 26 ...

Source

Zucchini and MacDonald (2009). Hidden Markov Models for Time Series: An Introduction using R. CRC Press.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Effective Sample Size (ESS)

Description

Estimates the ESS of a given vector of samples.

Usage

ESS(trace, tol = 1e-08, BIC = TRUE, digits=2)

Arguments

trace

vector of sampled values from an MCMC run (univariate only)

tol

ESS is returned as zero if the estimated spectrum at frequency zero is less than this value

BIC

if TRUE (default), spec0 is obtained using BIC; otherwise, AIC is used. See the details.

digits

integer indicating the approximate number of decimal places to be used

Details

Uses spec.ic to estimate the spectrum of the input at frequency zero (spec0). Then, ESS is estimated as ESS = length(trace)*var(trace)/spec0. See Examples for multivariate case.

ESS is discussed in detail in Example 6.31 of Time Series Analysis and Its Applications: With R Examples (5th ed, 2025).

Value

Returns the estimated ESS of the input.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

# How autocorrelation affects ESS
# get a few Markov chains
x   = matrix(NA, 500, 3)  # sample size is 500
phi = c(0,.3,.9)          # no, low, high
for (i in 1:3) x[,i] = sarima.sim(ar=phi[i])
apply(x, 2, ESS, digits=0)


Seismic Trace of Explosion number 6

Description

Seismic trace of an explosion [two phases or arrivals along the surface, the primary wave (t = 1,\dots,1024) and the shear wave (t = 1025,\dots,2048)] recorded at a seismic station.

Format

The format is: Time-Series [1:2048] from 1 to 2048: -0.001837 -0.000554 -0.002284 -0.000303 -0.000721 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

eqexp


Basic False Discovery Rate

Description

Computes the basic false discovery rate given a vector of p-values and returns the index of the maximal p-value satisfying the FDR condition.

Usage

FDR(pvals, qlevel = 0.05)

Arguments

pvals

a vector of pvals on which to conduct the multiple testing

qlevel

the proportion of false positives desired

Value

fdr.id

NULL if no significant tests, or the index of the maximal p-value satisfying the FDR condition.

Note

This is used primarily in Chapter 7.

Source

Built off of https://www.stat.berkeley.edu/~paciorek/code/fdr/fdr.R.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Quarterly U.S. GDP - updated to 2023

Description

Seasonally adjusted quarterly U.S. GDP from 1947(1) to 2023(1).

Format

The format is: Time-Series [1:305] from 1947 to 2023: 243.164 245.968 249.585 259.745 ...

Source

https://fred.stlouisfed.org/series/GDP

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

gdp, GNP, gnp


Quarterly U.S. GNP - updated to 2023

Description

Seasonally adjusted quarterly U.S. GNP from 1947(1) to 2003(1).

Format

The format is: Time-Series [1:305] from 1947 to 2023: 244.142 247.063 250.716 260.981 ...

Source

https://fred.stlouisfed.org/series/GNP

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

gnp, GDP, gdp


A Better Add Grid to a Plot

Description

Adds a grid to an existing plot with major and minor ticks. Works like R graphics grid() but the grid lines are solid and gray and minor ticks are produced by default.

Usage

Grid(nx = NULL, ny = nx, col = gray(0.9), lty = 1, lwd = par("lwd"), equilogs = TRUE,
    minor = TRUE, nxm = 2, nym = 2, tick.ratio = 0.5, xm.grid = TRUE, ym.grid = TRUE, ...)

Arguments

nx, ny

number of cells of the grid in x and y direction. When NULL, as per default, the grid aligns with the tick marks on the corresponding default axis (i.e., tickmarks as computed by axTicks). When NA, no grid lines are drawn in the corresponding direction.

col

color of the grid lines.

lty

line type of the grid lines.

lwd

line width of the grid lines.

equilogs

logical, only used when log coordinates and alignment with the axis tick marks are active. Setting equilogs = FALSE in that case gives non equidistant tick aligned grid lines.

minor

logical with TRUE (default) adding minor ticks.

nxm, nym

number of intervals in which to divide the area between major tick marks on the x-axis (y-axis). If minor=TRUE, should be > 1 or no minor ticks will be drawn.

tick.ratio

ratio of lengths of minor tick marks to major tick marks. The length of major tick marks is retrieved from par("tck").

xm.grid, ym.grid

if TRUE (default), adds grid lines at minor x-axis, y-axis ticks.

...

other graphical parameters;

Author(s)

D.S. Stoffer

Source

The code for grid() in R 'graphics' and minor.tick() from the 'Hmisc' package were combined and then washed, polished, and coated with a subtle metallic finish. The grid now sparkles in the sunlight.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

grid


Hematocrit Levels

Description

HCT: Measurements made for 91 days on the three variables, log(white blood count) [WBC], log(platelet) [PLT] and hematocrit [HCT]. Missing data code is 0 (zero).

Format

The format is: Time-Series [1:91] from 1 to 91: 30 30 28.5 34.5 34 32 30.5 31 33 34 ...

Details

See Examples 6.1 and 6.9 for more details.

Source

Jones, R.H. (1984). Fitting multivariate models to unequally spaced data. In Time Series Analysis of Irregularly Observed Data, pp. 158-188. E. Parzen, ed. Lecture Notes in Statistics, 25, New York: Springer-Verlag.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

blood, PLT, WBC


Snowshoe Hare

Description

This is one of the classic studies of predator-prey interactions, the 90-year data set is the number, in thousands, of snowshoe hare pelts purchased by the Hudson's Bay Company (HBC) of Canada. While this is an indirect measure of predation, the assumption is that there is a direct relationship between the number of pelts collected and the number of hare and lynx in the wild.

If you are interested in the brutal story of HBC, see the video https://www.nfb.ca/film/other_side_of_the_ledger or read the article https://canadiangeographic.ca/articles/the-untold-story-of-the-hudsons-bay-company.

Format

The format is: Time-Series [1:91] from 1845 to 1935: 19.6 19.6 19.6 12 28 ...

Note

This data set pairs with Lynx. The data are in units of one thousand.

Source

From Odum's "Fundamentals of Ecology", p. 191. Data listed at:
http://people.whitman.edu/~hundledr/courses/M250F03/M250.html
scroll down to: Chapter 6, Difference Equations.

NB: For some reason, there is not a secure and encrypted version of the site above.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

Lynx


Quick Kalman Filter

Description

Returns both the predicted and filtered values for various linear state space models; it also evaluates the likelihood at the given parameter values.

Usage

Kfilter(y, A, mu0, Sigma0, Phi, sQ, sR, Ups = NULL, Gam = NULL, 
         input = NULL, S = NULL, version = 1)

Arguments

y

data matrix (n x q), vector or time series, n = number of observations. Use NA or zero (0) for missing data.

A

can be constant or an array with dimension dim=c(q,p,n) if time varying (see details). Use NA or zero (0) for missing data.

mu0

initial state mean vector (p x 1)

Sigma0

initial state covariance matrix (p x p)

Phi

state transition matrix (p x p)

sQ

state error pre-matrix (see details)

sR

observation error pre-matrix (see details)

Ups

state input matrix (p x r); leave as NULL (default) if not needed

Gam

observation input matrix (q x r); leave as NULL (default) if not needed

input

NULL (default) if not needed or a matrix (n x r) of inputs having the same row dimension (n) as y

S

covariance matrix between the (not premultiplied) state and observation errors; not necessary to specify if not needed and only used if version=2. See details for more information.

version

either 1 (default) or 2; version 2 allows for correlated errors

Details

This script replaces Kfilter0, Kfilter1, and Kfilter2 by combining all cases. The major difference is how to specify the covariance matrices; in particular, sQ = t(cQ) and sR = t(cR) where cQ and cR were used in Kfilter0-1-2 scripts.

The states x_t are p-dimensional, the data y_t are q-dimensional, and the inputs u_t are r-dimensional for t=1, \dots, n. The initial state is x_0 \sim N(\mu_0, \Sigma_0).

The measurement matrices A_t can be constant or time varying. If time varying, they should be entered as an array of dimension dim = c(q,p,n). Otherwise, just enter the constant value making sure it has the appropriate q \times p dimension.

Version 1 (default): The general model is

x_t = \Phi x_{t-1} + \Upsilon u_{t} + sQ\, w_t \quad w_t \sim iid\ N(0,I)

y_t = A_t x_{t-1} + \Gamma u_{t} + sR\, v_t \quad v_t \sim iid\ N(0,I)

where w_t \perp v_t. Consequently the state noise covariance matrix is Q = sQ\, sQ' and the observation noise covariance matrix is R = sR\, sR' and sQ, sR do not have to be square as long as everything is conformable. Notice the specification of the state and observation covariances has changed from the original scripts.

NOTE: If it is easier to model in terms of Q and R, simply input the square root matrices sQ = Q %^% .5 and sR = R %^% .5.

Version 2 (correlated errors): The general model is

x_{t+1} = \Phi x_{t} + \Upsilon u_{t+1} + sQ\, w_t \quad w_t \sim iid\ N(0,I)

y_t = A_t x_{t-1} + \Gamma u_{t} + sR\, v_t \quad v_t \sim iid\ N(0,I)

where S = {\rm Cov}(w_t, v_t), and NOT {\rm Cov}(sQ\, w_t, sR\, v_t).

NOTE: If it is easier to model in terms of Q and R, simply input the square root matrices sQ = Q %^% .5 and sR = R %^% .5.

Note that in either version, sQ\, w_t has to be p-dimensional, but w_t does not, and sR\, v_t has to be q-dimensional, but v_t does not.

Value

Time varying values are returned as arrays.

Xp

one-step-ahead prediction of the state

Pp

mean square prediction error

Xf

filter value of the state

Pf

mean square filter error

like

the negative of the log likelihood

innov

innovation series

sig

innovation covariances

Kn

last value of the gain, needed for smoothing

Note

If it is easier to model in terms of Q and R, simply input the square root matrices sQ = Q%^%.5 and sR = R%^%.5.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

Ksmooth

Examples

# generate some data
 set.seed(1)
 sQ  = 1; sR = 3; n = 100  
 mu0 = 0; Sigma0 = 10; x0 = rnorm(1,mu0,Sigma0)
 w = rnorm(n); v = rnorm(n)
 x = c(x0 + sQ*w[1]);  y = c(x[1] + sR*v[1])   # initialize
for (t in 2:n){
  x[t] = x[t-1] + sQ*w[t]
  y[t] = x[t] + sR*v[t]   
  }
# run and plot the filter  
run = Kfilter(y, A=1, mu0, Sigma0, Phi=1, sQ, sR)

tsplot(cbind(x, y, Xf=run$Xf), spaghetti=TRUE, type='o', col=c(3,4,6), pch=c(NA,1,NA),
       addLegend=TRUE, location='topleft', lwd=c(2,1,2))


Quick Kalman Smoother

Description

Returns the smoother values for various linear state space models. The predicted and filtered values and the likelihood at the given parameter values are also returned (via Kfilter).

Usage

Ksmooth(y, A, mu0, Sigma0, Phi, sQ, sR, Ups = NULL, Gam = NULL, 
         input = NULL, S = NULL, version = 1)

Arguments

y

data matrix (n x q), vector or time series, n = number of observations. Use NA or zero (0) for missing data.

A

can be constant or an array with dimension dim=c(q,p,n) if time varying (see details). Use NA or zero (0) for missing data.

mu0

initial state mean vector (p x 1)

Sigma0

initial state covariance matrix (p x p)

Phi

state transition matrix (p x p)

sQ

state error pre-matrix (see details)

sR

observation error pre-matrix (see details)

Ups

state input matrix (p x r); leave as NULL (default) if not needed

Gam

observation input matrix (q x r); leave as NULL (default) if not needed

input

NULL (default) if not needed or a matrix (n x r) of inputs having the same row dimension (n) as y

S

covariance matrix between state and observation errors; not necessary to specify if not needed and only used if version=2; see details

version

either 1 (default) or 2; version 2 allows for correlated errors

Details

The states x_t are p-dimensional, the data y_t are q-dimensional, and the inputs u_t are r-dimensional for t=1, \dots, n. The initial state is x_0 \sim N(\mu_0, \Sigma_0).

The measurement matrices A_t can be constant or time varying. If time varying, they should be entered as an array of dimension dim = c(q,p,n). Otherwise, just enter the constant value making sure it has the appropriate q \times p dimension.

Version 1 (default): The general model is

x_t = \Phi x_{t-1} + \Upsilon u_{t} + sQ\, w_t \quad w_t \sim iid\ N(0,I)

y_t = A_t x_{t-1} + \Gamma u_{t} + sR\, v_t \quad v_t \sim iid\ N(0,I)

where w_t \perp v_t. Consequently the state noise covariance matrix is Q = sQ\, sQ' and the observation noise covariance matrix is R = sR\, sR' and sQ, sR do not have to be square as long as everything is conformable. Notice the specification of the state and observation covariances has changed from the original scripts.

NOTE: If it is easier to model in terms of Q and R, simply input the square root matrices sQ = Q %^% .5 and sR = R %^% .5.

Version 2 (correlated errors): The general model is

x_{t+1} = \Phi x_{t} + \Upsilon u_{t+1} + sQ\, w_t \quad w_t \sim iid\ N(0,I)

y_t = A_t x_{t-1} + \Gamma u_{t} + sR\, v_t \quad v_t \sim iid\ N(0,I)

where S = {\rm Cov}(w_t, v_t), and NOT {\rm Cov}(sQ\, w_t, sR\, v_t).

NOTE: If it is easier to model in terms of Q and R, simply input the square root matrices sQ = Q %^% .5 and sR = R %^% .5.

Note that in either version, sQ\, w_t has to be p-dimensional, but w_t does not, and sR\, v_t has to be q-dimensional, but v_t does not.

Value

Time varying values are returned as arrays.

Xs

state smoothers

Ps

smoother mean square error

X0n

initial mean smoother

P0n

initial smoother covariance

J0

initial value of the J matrix

J

the J matrices

Xp

state predictors

Pp

mean square prediction error

Xf

state filters

Pf

mean square filter error

like

negative of the log likelihood

innov

innovation series

sig

innovation covariances

Kn

the value of the last Gain

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

Kfilter

Examples

# generate some data
 set.seed(1)
 sQ  = 1; sR = 3; n = 100  
 mu0 = 0; Sigma0 = 10; x0 = rnorm(1,mu0,Sigma0)
 w = rnorm(n); v = rnorm(n)
 x = c(x0 + sQ*w[1]);  y = c(x[1] + sR*v[1])   # initialize
for (t in 2:n){
  x[t] = x[t-1] + sQ*w[t]
  y[t] = x[t] + sR*v[t]   
  }

# run and plot the smoother  
run = Ksmooth(y, A=1, mu0, Sigma0, Phi=1, sQ, sR)

tsplot(cbind(x, y, Xs=run$Xs), spaghetti=TRUE, type='o', col=c(3,4,6), pch=c(NA,1,NA),
       addLegend=TRUE, location='topleft', lwd=c(2,1,2), gg=TRUE)


Lagged Regression

Description

Performs lagged regression as discussed in Chapter 4.

Usage

LagReg(input, output, L = c(3, 3), M = 40, threshold = 0, 
        inverse = FALSE)

Arguments

input

input series

output

output series

L

degree of smoothing; see spans in the help file for spec.pgram.

M

must be even; number of terms used in the lagged regression

threshold

the cut-off used to set small (in absolute value) regression coeffcients equal to zero

inverse

if TRUE, will fit a forward-lagged regression

Details

For a bivariate series, input is the input series and output is the output series. The degree of smoothing for the spectral estimate is given by L; see spans in the help file for spec.pgram. The number of terms used in the lagged regression approximation is given by M, which must be even. The threshold value is the cut-off used to set small (in absolute value) regression coeffcients equal to zero (it is easiest to run LagReg twice, once with the default threshold of zero, and then again after inspecting the resulting coeffcients and the corresponding values of the CCF). Setting inverse=TRUE will fit a forward-lagged regression; the default is to run a backward-lagged regression. The script is based on code that was contributed by Professor Doug Wiens, Department of Mathematical and Statistical Sciences, University of Alberta.

Value

Graphs of the estimated impulse response function, the CCF, and the output with the predicted values superimposed.

beta

Estimated coefficients

fit

The output series, the fitted values, and the residuals

Note

See Chapter 4 of the text for an example.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Canadian Lynx

Description

This is one of the classic studies of predator-prey interactions, the 90-year data set is the number, in thousands, of lynx pelts purchased by the Hudson's Bay Company (HBC) of Canada. While this is an indirect measure of predation, the assumption is that there is a direct relationship between the number of pelts collected and the number of hare and lynx in the wild.

If you are interested in the brutal story of HBC, see the video https://www.nfb.ca/film/other_side_of_the_ledger or read the article https://canadiangeographic.ca/articles/the-untold-story-of-the-hudsons-bay-company.

Format

The format is: Time-Series [1:91] from 1845 to 1935: 30.1 45.1 49.1 39.5 21.2 ...

Note

The data are in units of one thousand. This data set pairs with Hare and is NOT the same as lynx.

Source

From Odum's "Fundamentals of Ecology", p. 191. Additional information at
http://people.whitman.edu/~hundledr/courses/M250F03/M250.html
scroll down to: Chapter 6, Difference Equations

NB: For some reason, there is not a secure and encrypted version of the site above.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

Hare


Multivariate El Nino/Southern Oscillation Index (version 1)

Description

Bimonthly MEI values, starting with Dec1949/Jan1950 through Oct/Nov2019. All values are normalized for each bimonthly season so that the 44 values from 1950 to 1993 have an average of zero and a standard deviation of 1. Larger values correspond to warmer temperatures (unlike soi and ENSO).

Format

The format is: Time-Series [1:827] from 1950 to 2019: -1.03 -1.13 -1.28 -1.07 -1.43 ...

Details

For full details, see https://psl.noaa.gov/enso/mei.old/mei.html. Multivariate ENSO Index (MEI) is a combined score on the six main observed variables over the tropical Pacific. These six variables are: sea-level pressure (P), zonal (U) and meridional (V) components of the surface wind, sea surface temperature (S), surface air temperature (A), and total cloudiness fraction of the sky (C). These observations have been collected and published in ICOADS for many years. The MEI is computed separately for each of twelve sliding bi-monthly seasons (Dec/Jan, Jan/Feb,..., Nov/Dec). After spatially filtering the individual fields into clusters, the MEI is calculated as the first unrotated Principal Component (PC) of all six observed fields combined. This is accomplished by normalizing the total variance of each field first, and then performing the extraction of the first PC on the co-variance matrix of the combined fields. In order to keep the MEI comparable, all seasonal values are standardized with respect to each season and to the 1950-93 reference period.

Weak El Nino: MEI is between +0.5 and +1.0.
Moderate El Nino: MEI is between +1.0 and +1.5.
Strong El Nino: MEI is between +1.5 and +2.0.
Very Strong El Nino: MEI is at or above +2.0.
Values below the negative of these indicate La Nina conditions.

Source

https://psl.noaa.gov/enso/mei.old/table.html

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

soi, ENSO, MEI2

Examples

tsplot(cbind(MEI, MEI2), spag=TRUE, col=2*2:1, addLegend=TRUE, nym=2, gg=TRUE)


tspairs(ts.intersect(MEI, MEI2), location='top')


Multivariate El Nino/Southern Oscillation Index (version 2)

Description

Bimonthly MEI values (version 2), starting with Dec1978/Jan1979 through Apr/May2025. These data are similar to MEI and larger values correspond to warmer temperatures (unlike soi and ENSO).

Format

The format is: Time-Series [1:557] from 1979 to 2025: 0.47 0.29 -0.05 0.21 0.27 -0.11 -0.11 0.47 0.38 0.23 ...

Details

For details, see https://www.psl.noaa.gov/enso/mei and MEI, which is version 1.

The key differences between MEI version 2 and version 1 are the input variables used, the source of the data, and the dates of the historical record. MEI version 2 relies on reanalysis data using modern numerical weather models to process and combine historical weather observations into a comprehensive, globally complete, and consistent dataset of past weather and climate and satellite data. This eliminates inconsistencies caused by relying on potentially less reliable ship observations, especially in earlier decades. The switch from cloud cover fraction to Outgoing Longwave Radiation (OLR) provides a more direct and accurate measurement of atmospheric convection, a critical component of ENSO. Despite the differences, MEI version 2 and the original MEI version 1 are very highly correlated for the overlapping period.

Weak El Nino: MEI is between +0.5 and +1.0.
Moderate El Nino: MEI is between +1.0 and +1.5.
Strong El Nino: MEI is between +1.5 and +2.0.
Very Strong El Nino: MEI is at or above +2.0.
Values below the negative of these indicate La Nina conditions.

Source

https://www.psl.noaa.gov/enso/mei

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

soi, ENSO, MEI

Examples

tsplot(cbind(MEI, MEI2), spag=TRUE, col=2*2:1, addLegend=TRUE, nym=2, gg=TRUE)

tspairs(ts.intersect(MEI, MEI2), location='top')


Month Labels

Description

Provides labels for the (English) months of the year to be used in plotting monthly time series.

Format

The format is: chr [1:12] "J" "F" "M" "A" "M" "J" "J" "A" "S" "O" "N" "D"

Note

Hi Kids. The months of the year in English are:

January, February, March, April, May, June, July, August, September, October, November, December.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

sAR = sarima.sim(sar=.9, S=12, n=36)
tsplot(sAR, type='c')
points(sAR, pch=Months, cex=1.1, font=4, col=1:4)

Platelet Levels

Description

PLT: Measurements made for 91 days on the three variables, log(white blood count) [WBC], log(platelet) [PLT] and hematocrit [HCT]. Missing data code is 0 (zero).

Usage

data(PLT)

Format

The format is: Time-Series [1:91] from 1 to 91: 4.47 4.33 4.09 4.6 4.41 ...

Details

See Examples 6.1 and 6.9 for more details.

Source

Jones, R.H. (1984). Fitting multivariate models to unequally spaced data. In Time Series Analysis of Irregularly Observed Data, pp. 158-188. E. Parzen, ed. Lecture Notes in Statistics, 25, New York: Springer-Verlag.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

blood, HCT, WBC


Normal Quantile-Quantile Plot

Description

Produces a normal QQ plot with a line of equality and a confidence band (by default) of the input data. This is basically a prettier version of qqnorm from the stats package.

Usage

QQnorm(xdata, col = c(4, 6), ylab = "Sample Quantiles", xlab = "Theoretical Quantiles", 
        main = "Normal Q-Q Plot", ylim = NULL, ci = TRUE, qqlwd = 1, ...)

Arguments

xdata

the data. If a matrix, the data are collapsed.

col

vector of 2, first is point color, second is line color (default is blue-4 and magenta-6).

ylab

y-axis label (default is 'Sample Quantiles').

xlab

x-axis label (default is 'Theoretical Quantiles').

main

plot title (default is 'Normal Q-Q Plot')

ylim

limits on y-axis (default is the most beautiful limits ever).

ci

if TRUE (default) draws pointwise 99.99% CIs as a band. If FALSE or 0, no CI is drawn. Alternately, enter a percentage (e.g., either ci=95 or ci=.95 will work).

qqlwd

line width of the qqline (default is 1).

...

other graphical parameters sent to tsplot.

Details

If you want a graphic to check normality of your data in xdata, just enter QQnorm(xdata) and sit back and enjoy the beauty of this script (you may want to wear sunglasses).

For confidence levels, various values are allowed. For example, 95% limits can be obtained as ci=95 or ci=.95, both of which are conventional. However, ci=5, or ci=.05 will also work for 95% intervals (so you can not go below 50%). If you ask for a confidence level of 100% or larger, you will get the default without a warning and maybe you are unconventional.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples


QQnorm(log(varve))


Fit Bayesian Stochastic Volatility Model

Description

Fits a stochastic volatility model to a univariate time series of returns.

Usage

SV.mcmc(y, nmcmc = 1000, burnin = 100, init = NULL, hyper = NULL, tuning = NULL, 
         sigma_MH = NULL, npart = NULL, mcmseed = NULL)

Arguments

y

single time series of returns

nmcmc

number of iterations for the MCMC procedure

burnin

number of iterations to discard for the MCMC procedure

init

initial values of (phi, sigma, beta) - default is c(0.9, 0.5, .1)

hyper

hyperparameters for bivariate normal distribution of (phi, sigma); user inputs (mu_phi, mu_q, sigma_phi, sigma_q, rho) - default is c(0.9, 0.5, 0.075, 0.3, -0.25)

tuning

tuning parameter - default is .03

sigma_MH

covariance matrix used for random walk Metropolis; it will be scaled by tuning in the script - default is matrix(c(1,-.25,-.25,1), nrow=2, ncol=2)

npart

number of particles used in particle filter - default is 10

mcmseed

seed for mcmc - default is 90210

Details

The log-volatility process is x_t and the returns are y_t. The SV model is

x_t = \phi x_{t-1} + \sigma w_t \qquad y_t = \beta \exp\{\frac{1}{2} x_t\}\epsilon_t

where w_t and \epsilon_t are independent standard normal white noise.

The model is fit using a technique described in the paper listed below (in the Source section) where the state parameters (\phi, \sigma) are sampled simultaneously with a bivariate normal prior specified in the arguments init and hyper.

Two graphics are returned: (1) the three parameter traces with the posterior mean highlighted, their ACFs [with effective sample sizes (ESS)], and their histograms with the .025, .5, and .975 quantiles displayed, and (2) the log-volatility posterior mean along with corresponding .95 credible intervals.

Value

Returned invisibly as a list:

phi

[[1]] vector of sampled state AR parameter

sigma

[[2]] vector of sampled state error stnd deviation

beta

[[3]] vector of sampled observation error scale

log.vol

[[4]] matrix of sampled log-volatility

options

[[5]] values of the input arguments

Note

Except for the data, all the other inputs have defaults. The time to run and the acceptance rate are returned at the end of the analysis. The acceptance rate should be around 30% and this is easily adjusted using the tuning parameter.

Author(s)

D.S. Stoffer

Source

Gong & Stoffer (2021). A note on efficient fitting of stochastic volatility models. Journal of Time Series Analysis, 42(2), 186-200. https://github.com/nickpoison/Stochastic-Volatility-Models

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

SV.mle

Examples

## Not run: 
#--   A minimal example  --##
myrun <- SV.mcmc(sp500w)   # results in object myrun - don't forget it 

str(myrun)                 # an easy way to see the default input options

## End(Not run)

Stochastic Volatility Model with Feedback via MLE

Description

Fits a stochastic volatility model with feedback (optional) to a univariate time series of returns via quasi-MLE.

Usage

SV.mle(returns, gamma = 0, phi = 0.95, sQ = 0.1, alpha = NULL, sR0 = 1, mu1 = -3, sR1 = 2, 
        rho = NULL, feedback = FALSE)

Arguments

returns

single time series of returns

gamma

feedback coefficient - included if feedback=TRUE (does not have to be specified)

phi

initial value of the log-volatility AR parameter (does not have to be specified)

sQ

initial value of the standard deviation of log-volatility noise (does not have to be specified)

alpha

initial value of the log-returns^2 constant parameter (does not have to be specified)

sR0

initial value of the log-returns^2 normal mixture standard deviation parameter (component 0 - does not have to be specified)

mu1

initial value of the log-returns^2 normal mixture mean parameter (component 1 - does not have to be specified)

sR1

initial value of the log-returns^2 normal mixture standard deviation parameter (component 1 - does not have to be specified)

rho

correlation between the state noise and observation noise (so called "leverage"). If feedback=TRUE this will be included if given a proper numerical value; if NULL (default) it is not included because it is often not significant when the feedback coefficient is included.

feedback

if TRUE feedback is included in the model; default is FALSE.

Details

The returns are r_t (input this). The log-volatility process is x_t and y_t = \log r_t^2.

If feedback=TRUE, the model is

x_{t+1} = \gamma r_t + \phi x_t + \sigma w_t \qquad y_t = \alpha + x_t + \eta_t

where w_t is standard normal noise. The observation error \eta_t is a mixture of two normals, N(0, \sigma_0^2) and N(\mu_1, \sigma_1^2). The state and observation noise can be correlated if \rho is given a value between -1 and 1.

If feedback=FALSE, \gamma and \rho are not included in the model.

Value

Returned invisibly:

PredLogVol

one-step-ahead predicted log-volatility

RMSPE

corresponding root MSPE

Coefficients

table of estimates and estimated standard errors

In addition to the one step ahead predicted log-volatility, corresponding root MSPE, and table of estimates returned invisibly, the estimates and SEs are printed and a graph of (1) the data with the predicted log-volatility, and (2) the normal mixture are displayed in one graphic.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

SV.mcmc

Examples

## Not run: 

SV.mle(sp500.gr, feedback=TRUE)

SV.mle(nyse)

## End(Not run)

Signal Extraction And Optimal Filtering

Description

Performs signal extraction and optimal filtering as discussed in Chapter 4.

Usage

SigExtract(series, L = c(3, 3), M = 50, max.freq = 0.05, col = 4)

Arguments

series

univariate time series to be filtered

L

degree of smoothing (may be a vector); see spans in spec.pgram for more details

M

number of terms used in the lagged regression approximation

max.freq

truncation frequency, which must be larger than 1/M

col

color of the main graphs

Details

The basic function of the script, and the default setting, is to remove frequencies above 1/20 (and, in particular, the seasonal frequency of 1 cycle every 12 time points). The sampling frequency of the time series is set to unity prior to the analysis.

Value

Returned invisibly as a list

series.filt

[[1]] the filtered series

filter

[[2]] the filter

Also prints the rounded filter coefficients and returns plots of (1) the original and filtered series, (2) the estimated spectra of each series, (3) the filter coefficients and the desired and attained frequency response function.

Note

The script is based on code that was contributed by Professor Doug Wiens, Department of Mathematical and Statistical Sciences, University of Alberta.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

## Not run: 

SigExtract(detrend(soi)) -> u
tsplot(cbind(soi.filtered=u[[1]], detrend(soi)), col=4*1:2, lwd=2:1, spag=TRUE, addLegend=TRUE)


## End(Not run)

U.S. Population - 1900 to 2010

Description

U.S. Population by official census, every ten years from 1900 to 2010.

Format

The format is: Time-Series [1:12] from 1900 to 2010: 76 92 106 123 132 ...

Details

The census from 2020 is not included in this data set because, by many accounts, it was a nightmare (https://www.npr.org/2022/01/15/1073338121/2020-census-interference-trump) due to the COVID-19 pandemic coupled with the fact that the Census Bureau is in the Department of Commerce, and its head is appointed by and reports directly to the POTUS, who at the time was DJ tRump: "Historians rank Trump among worst presidents in US history ... " (https://www.businessinsider.com/historians-rank-trump-among-worst-presidents-us-history-c-span-2021-6).

The data with the 2020 census is in USpop20. Note that the two data files differ a bit, presumably because they are revised ad infinitum. Both data sets were obtained from the Census Bureau's website.

Source

https://www.census.gov/

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

USpop20


U.S. Population - 1900 to 2020

Description

U.S. Population by official census, every ten years from 1900 to 2020, in millions.

Format

The format is: Time-Series [1:13] from 1900 to 2020: 76.2 92.2 106 122.8 132.2 ...

Details

The census from 2020 is included in this data set, but the results from 2020 are questionable. By many accounts, it was a nightmare (https://www.npr.org/2022/01/15/1073338121/2020-census-interference-trump) due to the COVID-19 pandemic coupled with the fact that the Census Bureau is in the Department of Commerce, and its head is appointed by and reports directly to the POTUS, who at the time was DJ tRump: "Historians rank Trump among worst presidents in US history ... " (https://www.businessinsider.com/historians-rank-trump-among-worst-presidents-us-history-c-span-2021-6).

The data without the 2020 census is in USpop. Note that the two data files differ a bit, presumably because they are revised ad infinitum. Both data sets were obtained from the Census Bureau's website.

Source

https://www.census.gov/

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

USpop

Examples

# the regression
t    = time(USpop20) - 1960
reg  = lm( USpop20~ poly(t, 10, raw=TRUE) )

# the prediction curve
b    = as.vector(coef(reg))
t    = 1900:2044
X    = outer(t - 1960, 0:10, FUN = "^")
pred = X %*% b

# the plot
tsplot(t, pred, ylab="Population", xlab='Year', cex.main=1, col=4,
        main="U.S. Population by Official Census")
points(time(USpop20), USpop20, pch=21, bg=rainbow(13), cex=1.25)
mtext(bquote('\u00D7'~10^6), side=2, line=1.5, adj=1, cex=.8)


U.S. Unemployment Rate

Description

Monthly U.S. unemployment rate in percent unemployed (Jan, 1948 - Nov, 2016, n = 827)

Format

The format is: Time-Series [1:827] from 1948 to 2017: 4 4.7 4.5 4 3.4 3.9 3.9 3.6 3.4 2.9 ...

Source

https://data.bls.gov/timeseries/LNU04000000/

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

unemp


White Blood Cell Levels

Description

WBC: Measurements made for 91 days on the three variables, log(white blood count) [WBC], log(platelet) [PLT] and hematocrit [HCT]. Missing data code is 0 (zero).

Format

The format is: Time-Series [1:91] from 1 to 91: 2.33 1.89 2.08 1.82 1.82 ...

Details

See Examples 6.1 and 6.9 for more details.

Source

Jones, R.H. (1984). Fitting multivariate models to unequally spaced data. In Time Series Analysis of Irregularly Observed Data, pp. 158-188. E. Parzen, ed. Lecture Notes in Statistics, 25, New York: Springer-Verlag.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

blood, HCT, PLT


Plot and print ACF or PACF of a time series

Description

Produces a plot (and a printout) of the sample ACF or PACF. The zero lag value of the ACF is removed.

Usage

acf1(series, max.lag = NULL, plot = TRUE, main = NULL, ylim = NULL, pacf = FALSE,
      ylab = NULL, xlab = NULL, na.action = na.pass, ...)

Arguments

series

The data (must be more than 2 observations). Does not have to be a time series object.

max.lag

Maximum lag. Can be omitted. Unless n < 60, defaults to \sqrt{n} + 10 or at least 4 seasons if the series is seasonal.

plot

If TRUE (default), a graph is produced and the values are rounded and listed. If FALSE, no graph is produced and the values are listed but not rounded by the script.

main

Title of graphic; defaults to name of series.

ylim

Specify limits for the y-axis.

pacf

If TRUE, the sample PACF is returned instead of ACF.

ylab

Change y-axis label from default.

xlab

Change x-axis label from default.

na.action

How to handle missing data; default is na.pass

...

Additional arguments passed to tsplot

Details

Will print and/or plot the sample ACF or PACF (if pacf=TRUE). The zero lag of the ACF (which is always 1) has been removed. If plot=TRUE, a graph is produced and the values are rounded and listed. If plot=FALSE, no graph is produced and the values are listed but not rounded by the script. The error bounds are approximate white noise bounds, -1/n \pm 2/\sqrt{n}; no other option is given.

Value

ACF

The sample ACF or PACF

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

acf2, acfm, ccf2

Examples

acf1(rnorm(100))

acf1(sarima.sim(ar=.9), pacf=TRUE)

acf1(soi, col=2:7, lwd=4, gg=TRUE)

Plot and print ACF and PACF of a time series

Description

Produces a simultaneous plot (and a printout) of the sample ACF and PACF on the same scale. The zero lag value of the ACF is removed.

Usage

acf2(series, max.lag = NULL, plot = TRUE, main = NULL, ylim = NULL, 
      na.action = na.pass, ...)

Arguments

series

The data (must be more than 2 observations). Does not have to be a time series object.

max.lag

Maximum lag. Can be omitted. Defaults to \sqrt{n} + 10 unless n < 60. If the series is seasonal, this will be at least 4 seasons by default.

plot

If TRUE (default), a graph is produced and the values are rounded and listed. If FALSE, no graph is produced and the values are listed but not rounded by the script.

main

Title of graphic; defaults to name of series.

ylim

Specify limits for the y-axis.

na.action

How to handle missing data; default is na.pass

...

Additional arguments passed to tsplot

Details

Will print and/or plot the sample ACF and PACF on the same scale. The zero lag of the ACF (which is always 1) has been removed. If plot=TRUE, a graph is produced and the values are rounded and listed. If plot=FALSE, no graph is produced and the values are listed but not rounded by the script. The error bounds are approximate white noise bounds, -1/n \pm 2/\sqrt{n}; no other option is given.

Value

ACF

The sample ACF

PACF

The sample PACF

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

acf1, acfm, ccf2

Examples

acf2(rnorm(100))

acf2(rnorm(100), 25, main=NA)   # no title

acf2(rnorm(100), max.lag=5, plot=FALSE)  # print only

acf2(soi, col=2:7, lwd=4, gg=TRUE) 

ACF and CCF for Multiple Time Series

Description

Produces a grid of plots of the sample ACF (diagonal) and CCF (off-diagonal). The values are returned invisibly.

Usage

acfm(series, max.lag = NULL,  na.action = na.pass, ylim = NULL,
      acf.highlight = TRUE, plot = TRUE, ...)

Arguments

series

Multiple time series (at least 2 columns of time series with more than 3 observations).

max.lag

Maximum lag. Can be omitted. Unless n < 60, defaults to \sqrt{n} + 10 or at least 4 seasons if the series is seasonal.

na.action

How to handle missing data; default is na.pass

ylim

Specify limits for the all correlation axes. If NULL (default) the values are a little wider than the min and max of all values.

acf.highlight

If TRUE (default), the diagonals (ACFs) are highlighted.

plot

If TRUE (default), you get a wonderful graphic.

...

Additional arguments passed to tsplot

Details

Produces a grid of plots of the sample ACF (diagonal) and CCF (off-diagonal). The plots in the grid are estimates of corr{x(t+LAG), y(t)}. Thus x leads y if LAG is positive and x lags y if LAG is negative. If plot is FALSE, then there is no graphic.

Value

The correlations are returned invisibly.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

acf1, acf2, ccf2

Examples

acfm(diff(log(econ5)), gg=TRUE)

acfm(diff(log(econ5)), 2, plot=FALSE) 

Bootstrap Distribution of AR Model Parameters

Description

Performs a nonparametric bootstrap to obtain the distribution of the AR model parameters.

Usage

ar.boot(series, order.ar, nboot = 500, seed = NULL, plot = TRUE, ...)

Arguments

series

time series data (univariate only)

order.ar

autoregression order - must be specified

nboot

number of bootstrap iterations (default is 500)

seed

seed for the bootstrap sampling (defalut is NULL)

plot

if TRUE (default) and order.ar > 1, returns a scatterplot matrix of the bootstrapped parameters, - the diagonals show a histogram.

...

if plot=TRUE and order.ar > 1, graphical parameters sent to tspairs

Details

For a specified series, finds the bootstrap distribution of the Yule-Walker estimates of \phi_1,\dots,\phi_p in the AR model specified by order.ar,

x_t = \mu + \phi_1 (x_{t-1}-\mu) + \dots + \phi_p (x_{t-p}-\mu) + w_t ,

where w_t is white noise. The data are centered by the sample mean prior to the bootstrap simulations.

The script displays a number of quantiles of the bootstrapped estimates, the means, the biases, and the root mean squared errors.

Value

Returned invisibly as a list:

phi.star

[[1]] bootstrapped AR parameters

x.sim

[[2]] bootstrapped data

mean.star

[[3]] bootstrapped mean

var.star

[[4]] bootstrapped noise variance

yw.fit

[[5]] results of Yule-Walker fit to the data

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

## Not run: 

u = ar.boot(rec, 2)
dev.new()
tspairs(u[[1]], hist=FALSE)   # another view of results
head(u[[1]])       # some booted AR parameters
head(u[[2]][,1:5]) # some booted data

## End(Not run)

Fit Bayesian AR Model

Description

Uses Gibbs sampling to fit an AR model to time series data.

Usage

ar.mcmc(xdata, porder, n.iter = 1000, n.warmup = 100, plot = TRUE,  
        prior_var_phi = 50, prior_sig_a = 1, prior_sig_b = 2, ...)

Arguments

xdata

time series data (univariate only)

porder

autoregression order

n.iter

number of iterations for the sampler

n.warmup

number of startup iterations for the sampler (these are removed)

plot

if TRUE (default) returns the draws after warmup (diagonal) and a scatterplot matrix of the draws (off-diagonal)

prior_var_phi

prior variance of the vector of AR coefficients; see details

prior_sig_a

first prior for the variance component; see details

prior_sig_b

second prior for the variance component; see details

...

additional graphic parameters passed to tspairs

Details

Assumes a normal-inverse gamma model,

x_t = \phi_0 + \phi_1 x_{t-1} + \dots + \phi_p x_{t-p} + \sigma z_t ,

where z_t is standard Gaussian noise. With \Phi being the (p+1)-dimensional vector of the \phis, the priors are \Phi \mid \sigma \sim N(0, \sigma^2 V_0) and \sigma^2 \sim IG(a,b), where V_0 = \gamma^2 I. Defaults are given for the hyperparameters, but the user may choose (a,b) as (prior_sig_a, prior_sig_b) and \gamma^2 as prior_var_phi.

The algorithm is efficient and converges quickly. Further details can be found in Chapter 6 of the 5th edition of the Springer text.

Value

In addition to the graphics (if plot is TRUE), the draws of each parameter (phi0, phi1, ..., sigma) are returned invisibly and means, standard deviations, and various quantiles are displayed.

Author(s)

D.S. Stoffer

Source

Based on the script arp.mcmc used in Douc, Moulines, & Stoffer, D. (2014). Nonlinear Time Series: Theory, Methods and Applications with R Examples. CRC press. ISBN 9781466502253.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

## Not run: 

u = ar.mcmc(rec, 2)

tspairs(u, hist=FALSE, col.diag=6)  # another view 

tsplot(u, ncol=2, col=4, xlab='Index')  # traces only


## End(Not run)

AR with Missing Values

Description

Data used in Chapter 6 Problems

Format

The format is: Time-Series [1:100] with NA for missing values.

Details

Simulated AR(1) with \phi=.9 and \sigma_w=1 and ~10% of the values missing at random (in this case, there happen to be 15 missing values). A similar data set can be generated as follows:

x   = sarima.sim(ar=.9, n=100)
u   = sample(c(NA,0), replace=TRUE, size=100, prob=c(.1,.9))
arm = x + u 

Another approach if you want exactly 10 missing values is this:

arms = sarima.sim(ar=.9, n=100)
arms[sample(1:100, size=10)] = NA

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

# use type='o' when plotting a series with missing data
par(mfrow=2:1)
tsplot(ar1miss, col=4)
tsplot(ar1miss, col=4, type='o', pch=19)


Simulated ARFIMA

Description

1000 simulated observations from an ARFIMA(1, 1, 0) model with \phi = .75 and d = .4.

Format

The format is: Time-Series [1:1000] from 1 to 1000: -0.0294 0.7487 -0.3386 -1.0332 -0.2627 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples


par(mfrow=2:1)
tsplot(arf, col=4, main='ARFIMA')
acf1(arf, col=4, main=NA)


Check an ARMA Model for Causality, Invertibility, and Parameter Redundancy

Description

For a given ARMA model (including seasonal models), reports whether the model is causal, invertible, or (approximately) over-parameterized.

Usage

arma.check(ar = 0, ma = 0, sar = NULL, sma = NULL, S = NULL, redtol = 0.1,
           plot.it = FALSE, ...)

Arguments

ar

vector of AR parameters

ma

vector of MA parameters

sar

vector of seasonal AR parameters (only specify for seasonal models)

sma

vector of seasonal MA parameters (only specify for seasonal models)

S

seasonal period (only specify for seasonal models - default value is 12)

redtol

tolerance for reporting parameter redundancy

plot.it

if TRUE -and- the model is causal and invertible, will plot the inverse roots and display the redundancy tolerance level, but ONLY for the AR and MA parts (seasonal parts are ignored)

...

additional graphical parameters

Details

Causality and invertibility are checked first. If either one or both are reported, checking is stopped.

If the model is causal and invertible, a warning for (possible) over-parameterization/redundancy is given if there are (approximate) common zeros.

To evaluate parameter redundancy, the inverse roots of the AR and MA polynomials are examined for closeness with redtol determining closeness; see the note.

For fun, and IF the model is causal and invertible, setting plot.it=TRUE will display the complex plane with the inverse roots of the AR and MA polynomials displayed with colored arrows; the seasonal components are not included because it's too messy. The tolerance level for declaring over-parameterization is also displayed in the graphic.

Value

See the details. If the model is causal and invertible and not over-parameterized, a nice message of validation is given. Otherwise, problems are reported but the specific culprits may not be specified.

Note

The Fisher Information matrix for ARMA is singular for exact redundancy, and its closeness to singularity can be measured by the closeness of the inverse of those roots [e.g., Klein and Spreij (1997). On Fisher's information matrix of an ARMA process. In Stochastic Differential and Difference Equations, 273-284. Boston: Birkhauser.]

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

arma.spec, sarima.sim, ARMAtoAR, ARMAtoMA

Examples

arma.check(ar=c(1,-.9), sar=-.6, sma=-.4, S=4)

arma.check(ar=.9, ma=c(-.9,-.8), sar=1, S=12)

# hard to tell from parameters alone ...
arma.check(ar=c(1.5,-.75), ma=c(-.6,-.3,.45), plot.it=TRUE, gg=TRUE)

Spectral Density of an ARMA Model

Description

Gives the ARMA model spectrum, but first tests for causality and invertibility, and then for parameter redundancy.

Usage

arma.spec(ar = 0, ma = 0, var.noise = 1, n.freq = 500, main = NULL, redundancy.tol=.1,
            frequency = 1, ylim = NULL, plot = TRUE, ...)

Arguments

ar

vector of AR parameters

ma

vector of MA parameters

var.noise

variance of the noise

n.freq

number of frequencies

main

title of graphic; default is "ARMA" with orders "(p, q)"

redundancy.tol

tolerance for reporting parameter redundancy

frequency

for plotting, adjusts the frequency axis units

ylim

optional; specify limits for the y-axis

plot

if TRUE (default), produces a graphic

...

additional arguments for the graphic

Details

The basic call is arma.spec(ar, ma) where ar and ma are vectors containing the model parameters. Use log='y' if you want the plot on a log scale.

If the model is not causal or invertible, a stop error with a message is given; e.g., arma.spec(ar=1, ma=1) will just produce warnings.

If there are (approximate) common zeros, a spectrum will be displayed and a warning will be given; e.g., arma.spec(ar= .9, ma= -.9) will yield a warning and the plot will be the spectrum of white noise. See arma.check for details on the evaluation of parameter redundancy.

Value

freq

frequencies - returned invisibly

spec

spectral ordinates - returned invisibly

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

arma.check

Examples

arma.spec(ar = c(1, -.9), ma = .8)

arma.spec(ar = c(1, -.9), log='y')

arma.spec(ar = -.9, ma=.89, gg=TRUE)  # almost white noise

# if you want a seasonal model, you have to be a little clever
arma.spec(ar=c(rep(0,11),.4), ma=.5, col=5, lwd=3, frequency=12)

astsa color palette with transparency or a color wheel

Description

The script does one of two things. [1] Easily modify the opacity level of the astsa colors. [2] Create a color wheel of a chosen number of colors from a base color.

Usage

astsa.col(col=1, alpha=1, wheel=FALSE, pie=FALSE, num, sat=NULL, val=NULL, ...)

Arguments

col

Either

  1. a numerical vector representing the colors to change transparency level -OR-

  2. a color used as a base for a wheel (if a vector, the first color is chosen)

- see Examples

alpha

factor in [0, 1] setting the opacity of all colors. Smaller values are more transparent.

wheel

if TRUE, produces a color wheel of num colors from a base color.

pie

if TRUE, produces a pie chart of the chosen colors.

num

an integer specifying the number of desired colors in the wheel. If missing, the user is prompted to enter a number.

sat

factor in [0, 1] setting the 'saturation' (intensity) of the colors. If NULL, the saturation from the base color is used.

val

factor in [0, 1] setting the 'value' (brightness) of the colors. If NULL, the value from the base color is used.

...

other graphical parameters for the pie chart; see pie.

Details

The astsa color palette is attached when the package is attached. The colors follow the R pattern of shades of: (1) black, (2) red, (3) green, (4) blue, (5) cyan, (6) magenta, (7) gold, (8) gray. The opacity of these colors can be changed easily using this script. Values are recycled, e.g., col=9 is the same as col=1.

Additionally, a color wheel can be generated by specifying a base color and inputting the number of desired colors. Using hsv, the script moves the 'hue' around the circle in equal steps holding 'saturation' and 'value' constant. This may be overridden by entering an alternate 'saturation' or 'value'.

In either application, a pie chart can be displayed to help in choosing the desired color scheme.

Value

[1] a color vector using the astsa color palette at the chosen transparency level
- OR -
[2] a color wheel of a chosen number num of colors from a base color

Author(s)

D.S.Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples


# View the astsa palette
astsa.col(1:8, pie=TRUE)
legend('topright', legend=astsa.col(1:8), fill=1:8, title='Hex Color Code')

# Plotting 2 series that touch (but in a nice way)
tsplot(cbind(gtemp_land, gtemp_ocean), col=astsa.col(c(4,2), .5), lwd=2, spaghetti=TRUE, 
     type='o', pch=20, ylab="Temperature Deviations", addLegend=TRUE, location='topleft',
     legend=c("Land Only", "Ocean Only"), gg=TRUE)  

# The hsv values for Dodgerblue3 (or astsa color 4)?
rgb2hsv(col2rgb(4))


# Wheels of fortune
vanna = par(no.readonly = TRUE)
par(mar=rep(0, 4))
layout( matrix(c(1,3,2,3), 2) )
astsa.col(4, wheel=TRUE, num=8, pie=TRUE)
astsa.col(4, wheel=TRUE, num=8, pie=TRUE, sat=.6, val=.9)
astsa.col(2, wheel=TRUE, num=100, pie=TRUE, border=FALSE, labels=NA)


# I'd like to solve the puzzle
par(vanna)  # reset graphic device
x = replicate(6, sarima.sim(ar=c(1.5,-.75), n=120))
tsplot(x, spag=TRUE, col=astsa.col(4, alpha=.7, wheel=TRUE, num=6), lwd=12)


autoParm - Structural Break Estimation Using AR Models

Description

Uses minimum description length (MDL) to fit piecewise AR processes with the goal of detecting changepoints in time series. Optimization is accomplished via a genetic algorithm (GA).

Usage

autoParm(xdata, Pi.B = NULL, Pi.C = NULL, PopSize = 70, generation = 70, P0 = 20, 
         Pi.P = 0.3, Pi.N = 0.3, NI = 7)

Arguments

xdata

time series (of length n at least 100) to be analyzed; the ts attributes are stripped prior to the analysis

Pi.B

probability of being a breakpoint in initial stage; default is 10/n. Does not need to be specified.

Pi.C

probability of conducting crossover; default is (n-10)/n. Does not need to be specified.

PopSize

population size (default is 70); the number of chromosomes in each generation. Does not need to be specified.

generation

number of iterations; default is 70. Does not need to be specified.

P0

maximum AR order; default is 20. If larger than 20, it is reset to 20. Does not need to be specified.

Pi.P

probability of taking parent's gene in mutation; default is 0.3. Does not need to be specified.

Pi.N

probability of taking -1 in mutation; default is 0.3 Does not need to be specified.

NI

number if islands; default is 7. Does not need to be specified.

Details

Details my be found in Davis, Lee, & Rodriguez-Yam (2006). Structural break estimation for nonstationary time series models. JASA, 101, 223-239. doi:10.1198/016214505000000745

Value

Returns three values, (1) the breakpoints including the endpoints, (2) the number of segments, and (3) the segment AR orders. See the examples.

Note

The GA is a stochastic optimization procedure and consequently will give different results at each run. It is a good idea to run the algorithm a few times before coming to a final decision.

Author(s)

D.S. Stoffer

Source

The code is adapted from R code provided to us by Rex Cheung (https://www.linkedin.com/in/rexcheung).

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

autoSpec

Examples

## Not run: 

##-- simulation
x1 = sarima.sim(ar=c(1.69, -.81), n=500)
x2 = sarima.sim(ar=c(1.32, -.81), n=500) 
x = c(x1, x2)

##-- look at the data
tsplot(x)

##-- run procedure
autoParm(x)

##-- output (yours will be slightly different - 
##--         the nature of GA) 
# returned breakpoints include the endpoints 
# $breakpoints
# [1]    1  514 1000
# 
# $number_of_segments
# [1] 2
# 
# $segment_AR_orders
# [1] 2 2

## End(Not run)

autoSpec - Changepoint Detection of Narrowband Frequency Changes

Description

Uses changepoint detection to discover if there have been slight changes in frequency in a time series. The autoSpec procedure uses minimum description length (MDL) to do nonparametric spectral estimation with the goal of detecting changepoints. Optimization is accomplished via a genetic algorithm (GA).

Usage

autoSpec(xdata, Pi.B = NULL, Pi.C = NULL, PopSize = 70, generation = 70, m0 = 10, 
         Pi.P = 0.3, Pi.N = 0.3, NI = 7, taper = .5, min.freq = 0, max.freq = .5)

Arguments

xdata

time series (of length n at least 100) to be analyzed; the ts attributes are stripped prior to the analysis

Pi.B

probability of being a breakpoint in initial stage; default is 10/n. Does not need to be specified.

Pi.C

probability of conducting crossover; default is (n-10)/n. Does not need to be specified.

PopSize

population size (default is 70); the number of chromosomes in each generation. Does not need to be specified.

generation

number of iterations; default is 70. Does not need to be specified.

m0

maximum width of the Bartlett kernel is 2*m0 + 1; default is 10. If larger than 20, m0 is reset to 20. Does not need to be specified.

Pi.P

probability of taking parent's gene in mutation; default is 0.3. Does not need to be specified.

Pi.N

probability of taking -1 in mutation; default is 0.3 Does not need to be specified.

NI

number if islands; default is 7. Does not need to be specified.

taper

half width of taper used in spectral estimate; .5 (default) is full taper. Does not need to be specified.

min.freq, max.freq

the frequency range (min.freq, max.freq) over which to calculate the Whittle likelihood; the default is (0, .5). Does not need to be specified. If min > max, the roles are reversed, and reset to the default if either is out of range.

Details

Details my be found in Stoffer, D. S. (2023). AutoSpec: Detection of narrowband frequency changes in time series. Statistics and Its Interface, 16(1), 97-108. doi:10.4310/21-SII703

Value

Returns three values, (1) the breakpoints including the endpoints, (2) the number of segments, and (3) the segment kernel orders. See the examples.

Note

The GA is a stochastic optimization procedure and consequently will give different results at each run. It is a good idea to run the algorithm a few times before coming to a final decision.

Author(s)

D.S. Stoffer

Source

The genetic algorithm code is adapted from R code provided to us by Rex Cheung (https://www.linkedin.com/in/rexcheung). The code originally supported Aue, Cheung, Lee, & Zhong (2014). Segmented model selection in quantile regression using the minimum description length principle. JASA, 109, 1241-1256. A similar version also supported Davis, Lee, & Rodriguez-Yam (2006). Structural break estimation for nonstationary time series models. JASA, 101, 223-239.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

autoParm

Examples

## Not run: 

##-- simulation
set.seed(1)
num = 500
t   = 1:num
w   = 2*pi/25
d   = 2*pi/150
x1  = 2*cos(w*t)*cos(d*t) + rnorm(num)
x2  = cos(w*t) + rnorm(num)
x   = c(x1,x2)

##-- plot and periodogram (all action below 0.1)
tsplot(x, main='not easy to see the change')
mvspec(x) 

##-- run procedure
autoSpec(x, max.freq=.1)

##-- output (yours will be slightly different - 
##--         the nature of GA) 
# returned breakpoints include the endpoints 
# $breakpoints
# [1]    1  503 1000
# 
# $number_of_segments
# [1] 2
# 
# $segment_kernel_orders_m
# [1] 2 4


##-- plot everything
par(mfrow=c(3,1))
tsplot(x, col=4)
 abline(v=503, col=6, lty=2, lwd=2)
mvspec(x[1:502],    kernel=bart(2), taper=.5, main='segment 1', col=4, xlim=c(0,.25))
mvspec(x[503:1000], kernel=bart(4), taper=.5, main='segment 2', col=4, xlim=c(0,.25))   

## End(Not run)

Bartlett Kernel

Description

Smoothing (triangular) kernel that decreases one unit from the center.

Usage

bart(m)

Arguments

m

non-negative integer specifying the kernel width, which is 2m + 1. If m has length larger than one, the convolution of the kernel is returned.

Details

Uses kernel from the stats package to construct a Bartlett (triangular) kernel of width 2m + 1; see help(kernel) for further details.

Value

Returns an object of class tskernel with the coefficients, the kernel dimension, and attribute "Bartlett".

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

bart(4)                         # for a list
plot(bart(4), ylim=c(.01,.21))  # for a graph

Infrasonic Signal from a Nuclear Explosion

Description

Infrasonic signal from a nuclear explosion.

Usage

data(beamd)

Format

A data frame with 2048 observations (rows) on 3 numeric variables (columns): sensor1, sensor2, sensor3.

Details

This is a data frame consisting of three columns (that are not time series objects). The data are an infrasonic signal from a nuclear explosion observed at sensors on a triangular array.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


U.S. Monthly Live Births

Description

Monthly live births (adjusted) in thousands for the United States, 1948-1979.

Format

The format is: Time-Series [1:373] from 1948 to 1979: 295 286 300 278 272 268 308 321 313 308 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Daily Blood Work with Missing Values

Description

Multiple time series of measurements made for 91 days on the three variables, log(white blood count) [WBC], log(platelet) [PLT] and hematocrit [HCT]. Missing data code is NA.

Format

Time-Series [1:91, 1:3] from 1 to 91: 2.33 1.89 2.08 1.82 1.82 ...

..$ : NULL ..$ : chr [1:3] "WBC" "PLT" "HCT"

Details

This data set is used in Chapter 6 for a missing data example.

Source

Jones, R.H. (1984). Fitting multivariate models to unequally spaced data. In Time Series Analysis of Irregularly Observed Data, pp. 158-188. E. Parzen, ed. Lecture Notes in Statistics, 25, New York: Springer-Verlag.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

HCT, PLT, WBC

Examples

# use type='o' when plotting series with missing data
tsplot(blood, type='o', pch=19, cex=1.1, col=2:4, gg=TRUE, xlab='day')

Nucleotide sequence - BNRF1 Epstein-Barr

Description

Nucleotide sequence of the BNRF1 gene of the Epstein-Barr virus (EBV): 1=A, 2=C, 3=G, 4=T. The data are used in Chapter 7.

Format

The format is: Time-Series [1:3954] from 1 to 3954: 1 4 3 3 1 1 3 1 3 1 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

head(bnrf1ebv)
head(dna2vector(bnrf1ebv))

Nucleotide sequence - BNRF1 of Herpesvirus saimiri

Description

Nucleotide sequence of the BNRF1 gene of the herpesvirus saimiri (HVS): 1=A, 2=C, 3=G, 4=T. The data are used in Chapter 7.

Format

The format is: Time-Series [1:3741] from 1 to 3741: 1 4 3 2 4 4 3 4 4 4 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

head(bnrf1hvs)
head(dna2vector(bnrf1hvs))

Monthly Carbon Dioxide Levels at Mauna Loa

Description

Monthly mean carbon dioxide (in ppm) measured at Mauna Loa Observatory, Hawaii. This is an update to co2 in the datasets package.

Format

The format is: Time-Series [1:781] from 1958 to 2023: 316 317 318 317 316 ...

Details

The carbon dioxide data measured as the mole fraction in dry air, on Mauna Loa constitute the longest record of direct measurements of CO2 in the atmosphere. They were started by C. David Keeling of the Scripps Institution of Oceanography in March of 1958 at a facility of the National Oceanic and Atmospheric Administration. NOAA started its own CO2 measurements in May of 1974, and they have run in parallel with those made by Scripps since then. Data are reported as a dry mole fraction defined as the number of molecules of carbon dioxide divided by the number of molecules of dry air multiplied by one million (ppm).

Due to the eruption of the Mauna Loa Volcano, measurements from Mauna Loa Observatory were suspended as of Nov. 29, 2022. Observations starting in December 2022 are from a site at the Maunakea Observatories, approximately 21 miles north of the Mauna Loa Observatory.

Note

The reason this data file is called cardox is because R has two datasets called CO2 and co2, which doesn't leave many options if you don't want to create potential problems like the dplyr people. Anyway, cardox sounds like the name of a cool character in some SciFi movie.

Source

https://gml.noaa.gov/ccgg/trends/

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Cross Correlation

Description

Calculates and plots the sample CCF of two time series.

Usage

ccf2(x, y, max.lag = NULL, main = NULL, ylab = "CCF", plot = TRUE,
         na.action = na.pass, type = c("correlation", "covariance"), ...)

Arguments

x, y

univariate time series

max.lag

maximum lag for which to calculate the CCF. Can be omitted. Unless n < 50, defaults to \sqrt{n} + 10 or at least 3 seasons if the series is seasonal.

main

plot title - if NULL, uses x and y names

ylab

vertical axis label; default is 'CCF'

plot

if TRUE (default) a graphic is produced and the values are returned invisibly. Otherwise, the values are returned.

na.action

how to handle missing values; default is na.pass

type

default is cross-correlation; an option is cross-covariance

...

additional arguments passed to tsplot

Details

This will produce a graphic of the sample corr[x(t+lag), y(t)] from -max.lag to max.lag. Also, the (rounded) values of the CCF are returned invisibly unless plot=FALSE. Similar details apply to the cross-covariance.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

pre.white, acf1, acf2, acfm

Examples

ccf2(soi, rec, plot=FALSE, max.lag=6)  # now you see it
ccf2(soi, rec)                          # now you don't

# happy birthday
ccf2(soi, rec, col=astsa.col(4, wheel=TRUE, num=6), lwd=4, gg=TRUE)

Monthly price of a pound of chicken

Description

Poultry (chicken), Whole bird spot price, Georgia docks, US cents per pound

Format

The format is: Time-Series [1:180] from August 2001 to July 2016: 65.6 66.5 65.7 64.3 63.2 ...

Source

https://www.indexmundi.com/commodities/

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Lake Shasta inflow data

Description

Lake Shasta inflow data. This is a data frame.

Format

A data frame with 454 observations (rows) on the following 6 numeric variables (columns): Temp, DewPt, CldCvr, WndSpd, Precip, Inflow.

Details

The data are 454 months of measured values for the climatic variables: air temperature, dew point, cloud cover, wind speed, precipitation, and inflow, at Lake Shasta, California.

Lake Shasta is a man-made reservoir that is situated on ancestral lands of the Shasta Indian Nation. The area around the lake was once a thriving homeland for the Shasta. The construction of the reservoir submerged many of these significant cultural sites, leading to displacement and hardship for the Shasta people. The California Gold Rush drew in outsiders in the late 1840s. For the Shasta, this was a devastating process as thousands of miners who did not respect the Shasta or their homeland, operated along various waterways. Introduction of diseases and fighting against white people, rapidly reduced the number of Shasta. For more information, see https://www.legendsofamerica.com/shasta-indians.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

tsplot(climhyd, ncolm=2, col=2:7, lwd=2, scale=.9)

Cardiovascular Mortality from the LA Pollution study

Description

Average weekly cardiovascular mortality in Los Angeles County; 508 six-day smoothed averages obtained by filtering daily values over the 10 year period 1970-1979.

Format

The format is: Time-Series [1:508] from 1970 to 1980: 97.8 104.6 94.4 98 95.8 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lap, lap.xts


Hard Drive Cost per GB

Description

Median annual cost per gigabyte (GB) of storage.

Format

The format is: Time-Series [1:29] from 1980 to 2008: 213000.00 295000.00 260000.00 175000.00 160000.00 ...

Note

This is a good data set for a first exercise on regression with autocorrelated errors.

Source

The data are retail prices per GB taken from a sample of manufacturers listed at https://mkomo.com/cost-per-gigabyte. From there, the median cost per GB was computed by year.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Detrend a Time Series

Description

Returns a time series with the trend removed. The trend can be estimated using polynomial regression or using a lowess fit.

Usage

detrend(series, order = 1, lowess = FALSE, lowspan = 2/3)

Arguments

series

The time series to be detrended.

order

Order of the polynomial used to estimate the trend with a linear default (order=1) unless lowess is TRUE.

lowess

If TRUE, lowess is used to find the trend. The default is FALSE.

lowspan

The smoother span used for lowess.

Value

The detrended series is returned.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

trend

Examples

tsplot( cbind(salmon, detrend(salmon)), gg=TRUE, main='Norwegian Salmon USD/KG' ) 

Dow Jones Industrial Average

Description

Daily DJIA values from April 2006 - April 2016

Format

The format is: xts [1:2518, 1:5] 11279 11343 11347 11337 11283 ...
- attr(*, "class")= chr [1:2] "xts" "zoo"
..$ : chr [1:5] "Open" "High" "Low" "Close" "Volume"

Source

The data were obtained via the TTR package and Yahoo financial data. Unfortunately, this does not work now. It seems like the R package quantmod is a good bet and Yahoo still has financial data.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples


# the file is an 'xts' data file
# if 'xts' is not installed you can still do this

tsplot(djia, ncolm=2, col=2:6)               # no dates
tsplot(timex(djia), djia, ncolm=2, col=2:6)  # dates 

# differencing (on its own) loses an obs 
return = diff(log(djia[,'Close']))
tsplot(timex(djia)[-1], return, col=4, gg=TRUE, main='DJIA')


Convert DNA Sequence to Indicator Vectors

Description

Takes a string (e.g., a DNA sequence) of general form (e.g., FASTA) and converts it to a sequence of indicator vectors for use with the Spectral Envelope (specenv).

Usage

dna2vector(data, alphabet = NULL)

Arguments

data

A single string.

alphabet

The particular alphabet being used. The default is alphabet=c("A", "C", "G", "T").

Details

Takes a string of categories and converts it to a matrix of indicators. The data can then be used by the script specenv, which calculates the Spectral Envelope of the sequence (or subsequence). Many different type of sequences can be used, including FASTA and GenBank, as long as the data is a string of categories.

The indicator vectors (as a matrix) are returned invisibly in case the user forgets to put the results in an object wherein the screen would scroll displaying the entire sequence. In other words, the user should do something like xdata = dna2vector(data) where data is the original sequence.

If the DNA sequence is in a FASTA file, say sequence.fasta, the following code can be used to read the data into the session, create the indicator sequence and save it as a compressed R data file:

  fileName <- 'sequence.fasta'      # name of FASTA file
  data     <- readChar(fileName, file.info(fileName)$size)  # input the sequence
  myseq    <- dna2vector(data)      # convert it to indicators

  ##== to compress and save the data ==##
  save(myseq, file='myseq.rda')
  ##== and then load it when needed ==##
  load('myseq.rda')

Value

matrix of indicator vectors; returned invisibly

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

specenv

Examples

# Epstein-Barr virus (entire sequence included in astsa)
substr(EBV, start=1, stop=25)
xdata = dna2vector(EBV)
head(xdata)

# part of EBV with  1, 2, 3, 4 for "A", "C", "G", "T"
xdata = dna2vector(bnrf1ebv)
head(xdata)

# raw GenBank sequence
data <-
c("1 agaattcgtc ttgctctatt cacccttact tttcttcttg cccgttctct ttcttagtat
  61 gaatccagta tgcctgcctg taattgttgc gccctacctc ttttggctgg cggctattgc")
xdata = dna2vector(data, alphabet=c('a', 'c', 'g', 't'))
head(xdata)

# raw FASTA sequence
data <-
 c("AGAATTCGTCTTGCTCTATTCACCCTTACTTTTCTTCTTGCCCGTTCTCTTTCTTAGTATGAATCCAGTA
    TGCCTGCCTGTAATTGTTGCGCCCTACCTCTTTTGGCTGGCGGCTATTGCCGCCTCGTGTTTCACGGCCT")
xdata = dna2vector(data)
head(xdata)

Five Quarterly Economic Series

Description

Multiple time series of quarterly U.S. unemployment, GNP, consumption, and government and private investment, from 1948-III to 1988-II.

Format

Multiple time series with 161 observations (rows) on the following 5 numeric variables (columns): unemp, gnp, consum, govinv, prinv.

Note

unemp is in percentage (of the labor force), and the others are in 1982 Billions USD.

Source

Young, P.C. and Pedregal, D.J. (1999). Macro-economic relativity: government spending, private investment and unemployment in the USA 1948-1998. Structural Change and Economic Dynamics, 10, 359-380.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

tsplot(econ5, ncolm=2, col=2:6, lwd=2, title=colnames(econ5), 
         ylab=c('%', rep('Billions-USD', 4)))

Earthquake and Explosion Seismic Series

Description

This is a data frame of the earthquake and explosion seismic series used throughout the text.

Format

A data frame with 2048 observations (rows) on 17 variables (columns). Each column is a numeric vector.

Details

The matrix has 17 columns, the first eight are earthquakes, the second eight are explosions, and the last column is the Novaya Zemlya event of unknown origin.

The column names are: EQ1, EQ2,...,EQ8; EX1, EX2,...,EX8; NZ. The first 1024 observations correspond to the P wave, the second 1024 observations correspond to the S wave.

All events in the data set were on or near land and were distributed uniformly over Scandinavia so as to minimize the possibility that discriminators might be keying on location or land-sea differences. The events are earthquakes ranging in magnitude from 2.74 to 4.40 and explosions in the range 2.13 to 2.19. Also added is an event of uncertain origin that was located in the Novaya Zemlya region of Russia. All events except the Russian event occurred in the Scandinavian peninsula and were recorded by seismic arrays located in Norway by Norwegian and Arctic experimental seismic stations (NORESS, ARCESS) and in Finland by Finnish experimental seismic stations (FINESS).

No. Type Date Array Magnitude Latitude Longitude
1 EQ 6/16/92 FINESS 3.22 65.5 22.9
2 EQ 8/24/91 ARCESS 3.18 65.7 32.1
3 EQ 9/23/91 NORESS 3.15 64.5 21.3
4 EQ 7/4/92 FINESS 3.60 67.8 15.1
5 EQ 2/19/92 ARCESS 3.26 59.2 10.9
6 EQ 4/13/92 NORESS 4.40 51.4 6.1
7 EQ 4/14/92 NORESS 3.38 59.5 5.9
8 EQ 5/18/92 NORESS 2.74 66.9 13.7
9 EX 3/23/91 ARCESS 2.85 69.2 34.3
10 EX 4/13/91 FINESS 2.60 61.8 30.7
11 EX 4/26/91 ARCESS 2.95 67.6 33.9
12 EX 8/3/91 ARCESS 2.13 67.6 30.6
13 EX 9/5/91 ARCESS 2.32 67.1 21.0
14 EX 12/10/91 FINESS 2.59 59.5 24.1
15 EX 12/29/91 ARCESS 2.96 69.4 30.8
16 EX 3/25/92 NORESS 2.94 64.7 30.8
17 NZ 12/31/92 NORESS 2.50 73.6 55.2

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

# view all series 
# first 2 rows EQs - next 2 rows EXs
# 5th row NZ event 

tsplot(eqexp, ncol=4, col=c(rep(6,8),rep(4,8),2), scale=.75)

## Not run: 

# for a nice html map, use the 'leaflet' package

library(leaflet)   # install if you don't have it

lat = c(
65.5,65.7,64.5,67.8,59.2,51.4,59.5,66.9,
69.2,61.8,67.6,67.6,67.1,59.5,69.4,64.7,
73.6)

long = c(
22.9,32.1,21.3,15.1,10.9,6.1,5.9,13.7,
34.3,30.7,33.9,30.6,21.0,24.1,30.8,30.8,
55.2)

event = c(
"EQ1","EQ2","EQ3","EQ4","EQ5","EQ6","EQ7","EQ8",
"EX1","EX2","EX3","EX4","EX5","EX6","EX7","EX8",
"NZ")


eventmap = data.frame(
  longitude = long,
  latitude = lat,
  event = event )

leaflet(eventmap) %>%
  addTiles() %>% 
  addMarkers(~longitude, ~latitude, label = ~event,
    labelOptions = labelOptions(noHide = TRUE))


## End(Not run)

Forward Filtering Backward Sampling

Description

FFBS algorithm for state space models

Usage

ffbs(y, A, mu0, Sigma0, Phi, sQ, sR, Ups = NULL, Gam = NULL, input = NULL)

Arguments

y

Data matrix, vector or time series.

A

Observation matrix. Can be constant or an array with dim=c(q,p,n) if time varying.

mu0

Initial state mean.

Sigma0

Initial state covariance matrix.

Phi

State transition matrix.

sQ

State error covariance matrix is Q = sQ%*%t(sQ) – see details below. In the univariate case, it is the standard deviation.

sR

Observation error covariance matrix is R = sR%*%t(sR) – see details below. In the univariate case, it is the standard deviation.

Ups

State input matrix.

Gam

Observation input matrix.

input

matrix or vector of inputs having the same row dimension as y.

Details

For a linear state space model, the FFBS algorithm provides a way to sample a state sequence x_{0:n} from the posterior \pi(x_{0:n} \mid \Theta, y_{1:n}) with parameters \Theta and data y_{1:n}.

The general model is

x_t = \Phi x_{t-1} + \Upsilon u_{t} + sQ\, w_t \quad w_t \sim iid\ N(0,I)

y_t = A_t x_{t-1} + \Gamma u_{t} + sR\, v_t \quad v_t \sim iid\ N(0,I)

where w_t \perp v_t. Consequently the state noise covariance matrix is Q = sQ\, sQ' and the observation noise covariance matrix is R = sR\, sR' and sQ, sR do not have to be square as long as everything is conformable.

x_t is p-dimensional, y_t is q-dimensional, and u_t is r-dimensional. Note that sQ\, w_t has to be p-dimensional, but w_t does not, and sR\, v_t has to be q-dimensional, but v_t does not.

Value

Xs

An array of sampled states

X0n

The sampled initial state (because R is 1-based)

Note

The script uses Kfilter. If A_t is constant wrt time, it is not necessary to input an array; see the example. The example below is just one pass of the algorithm; see the example at FUN WITH ASTSA for the real fun.

Author(s)

D.S. Stoffer

Source

Chapter 6 of the Shumway and Stoffer Springer text.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

## Not run: 

## -- this is just one pass --##
# generate some data
 set.seed(1)
 sQ  = 1; sR = 3; n = 100  
 mu0 = 0; Sigma0 = 10; x0 = rnorm(1,mu0,Sigma0)
 w = rnorm(n); v = rnorm(n)
 x = c(x0 + sQ*w[1]);  y = c(x[1] + sR*v[1])   # initialize
for (t in 2:n){
  x[t] = x[t-1] + sQ*w[t]
  y[t] = x[t] + sR*v[t]   
  }

## run one pass of FFBS, plot data, states and sampled states  
run = ffbs(y, A=1, mu0=0, Sigma0=10, Phi=1, sQ=1, sR=3)
tsplot(cbind(y,run$Xs), spaghetti=TRUE, type='o', col=c(8,4), pch=c(1,NA))
legend('topleft', legend=c("y(t)","xs(t)"), lty=1, col=c(8,4), bty="n", pch=c(1,NA))

## End(Not run)

Monthly pneumonia and influenza deaths in the U.S., 1968 to 1978.

Description

Monthly pneumonia and influenza deaths per 10,000 people in the United States for 11 years, 1968 to 1978.

Usage

data(flu)

Format

The format is: Time-Series [1:132] from 1968 to 1979: 0.811 0.446 0.342 0.277 0.248 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


fMRI - complete data set

Description

Data (as a vector list) from an fMRI experiment in pain, listed by location and stimulus. The data are BOLD signals when a stimulus was applied for 32 seconds and then stopped for 32 seconds. The signal period is 64 seconds and the sampling rate was one observation every 2 seconds for 256 seconds (n = 128). The number of subjects under each condition varies.

Details

The LOCATIONS of the brain where the signal was measured were [1] Cortex 1: Primary Somatosensory, Contralateral, [2] Cortex 2: Primary Somatosensory, Ipsilateral, [3] Cortex 3: Secondary Somatosensory, Contralateral, [4] Cortex 4: Secondary Somatosensory, Ipsilateral, [5] Caudate, [6] Thalamus 1: Contralateral, [7] Thalamus 2: Ipsilateral, [8] Cerebellum 1: Contralateral and [9] Cerebellum 2: Ipsilateral.

The TREATMENTS or stimuli (and number of subjects in each condition) are [1] Awake-Brush (5 subjects), [2] Awake-Heat (4 subjects), [3] Awake-Shock (5 subjects), [4] Low-Brush (3 subjects), [5] Low-Heat (5 subjects), and [6] Low-Shock (4 subjects). Issue the command summary(fmri) for further details. In particular, awake (Awake) or mildly anesthetized (Low) subjects were subjected levels of periodic brushing (Brush), application of heat (Heat), and mild shock (Shock) effects.

As an example, fmri$L1T6 (Location 1, Treatment 6) will show the data for the four subjects receiving the Low-Shock treatment at the Cortex 1 location; note that fmri[[6]] will display the same data.

Source

Joseph F. Antognini, Michael H. Buonocore, Elizabeth A. Disbrow, Earl Carstens, Isoflurane anesthesia blunts cerebral responses to noxious and innocuous stimuli: a fMRI study, Life Sciences, Volume 61, Issue 24, 1997, Pages PL349-PL354, ISSN 0024-3205,
https://doi.org/10.1016/S0024-3205(97)00960-0.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


fMRI Data Used in Chapter 1

Description

A data frame that consists of average fMRI BOLD signals at eight locations.

Usage

data(fmri1)

Format

The format is: mts [1:128, 1:9]

Details

Multiple time series consisting of fMRI BOLD signals at eight locations (in columns 2-9, column 1 is time period), when a stimulus was applied for 32 seconds and then stopped for 32 seconds. The signal period is 64 seconds and the sampling rate was one observation every 2 seconds for 256 seconds (n = 128). The columns are labeled: "time" "cort1" "cort2" "cort3" "cort4" "thal1" "thal2" "cere1" "cere2".

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

fmri

Examples

tsplot(fmri1[,2:9], ncolm=4, gg=TRUE, col=c(rep(4,4),rep(3,2),rep(6,2)))

Gas Prices

Description

New York Harbor conventional regular gasoline weekly spot price FOB (in cents per gallon) from 2000 to mid-2010.

Format

The format is: Time-Series [1:545] from 2000 to 2010: 70.6 71 68.5 65.1 67.9 ...

Details

Pairs with series oil

Source

Data were obtained from: https://www.eia.gov/dnav/pet/pet_pri_spt_s1_w.htm

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

oil

Examples

tsplot(cbind(gas,oil), spag=TRUE, col=2*1:2, addLegend=TRUE)


Quarterly U.S. GDP

Description

Seasonally adjusted quarterly U.S. GDP from 1947(1) to 2018(3).

Format

The format is: Time-Series [1:287] from 1947 to 2018: 2033 2028 2023 2055 2086 ...

Source

https://tradingeconomics.com/united-states/gdp

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

GDP, GNP, gnp


Quarterly U.S. GNP

Description

Seasonally adjusted quarterly U.S. GNP from 1947(1) to 2002(3).

Format

The format is: Time-Series [1:223] from 1947 to 2002: 1489 1497 1500 1524 1547 ...

Source

https://fred.stlouisfed.org/series/GNP

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

GNP, GDP, gdp


Monthly global average surface temperatures by year

Description

Monthly global average surface temperatures by year. The temperature of the air measured 2 meters above the ground, encompassing land, sea, and in-land water surfaces.

Format

A data frame with 12 monthly observations (as rows) for the years 1975-2023 (as columns in reverse order).

Details

Temperature of air at 2m above the surface of land, sea or in-land waters. 2m temperature is calculated by interpolating between the lowest model level and the Earth's surface, taking account of the atmospheric conditions. Technical details at https://cds.climate.copernicus.eu/datasets/reanalysis-era5-pressure-levels-monthly-means?tab=overview.

Source

https://ourworldindata.org/grapher/monthly-average-surface-temperatures-by-year

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

# functional data plot showing global warming
tsplot(gtemp.month, spaghetti=TRUE, col=rainbow(49, start=.2, v=.8, rev=TRUE), ylab='\u00b0C', 
        xlab='Month', xaxt='n', main='Mean Monthly Global Temperature', lwd=c(3,rep(1,47),3))
axis(1, labels=Months, at=1:12)
text(10, 13, '1975')
text(10.3, 15.5, '2023')


Global mean land and open ocean temperature deviations, 1850-2023

Description

Annual temperature anomalies (in degress centigrade) averaged over the Earth's land and ocean area from 1850 to 2023. Anomalies are with respect to the 1991-2020 average.

Format

The format is: Time-Series [1:174] from 1850 to 2023: -0.24 -0.25 -0.27 -0.15 -0.05 -0.16 -0.29 -0.32 -0.19 -0.04 ...

Source

https://www.ncei.noaa.gov/access/monitoring/climate-at-a-glance/global/time-series/

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

gtemp_land, gtemp_ocean


Global mean land temperature deviations, 1850-2023

Description

Annual temperature anomalies (in degress centigrade) averaged over the Earth's land area from 1850 to 2023. Anomalies are with respect to the 1991-2020 average.

Format

The format is: Time-Series [1:174] from 1850 to 2023: -0.50 -0.60 -0.50 -0.50 -0.20 -0.50 -0.80 -0.40 -0.40 -0.10 ...

Source

https://www.ncei.noaa.gov/access/monitoring/climate-at-a-glance/global/time-series/

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

gtemp_ocean, gtemp_both


Global mean ocean temperature deviations, 1850-2023

Description

Annual sea surface temperature anomalies averaged over the part of the ocean that is free of ice at all times (open ocean) from 1850 to 2023. Anomalies are with respect to the 1991-2020 average.

Format

The format is: Time-Series [1:174] from 1850 to 2023: -0.12 -0.08 -0.14 0.04 0.04 0.00 -0.05 -0.27 -0.09 0.01 ...

Source

https://www.ncei.noaa.gov/access/monitoring/climate-at-a-glance/global/time-series/

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

gtemp_land, gtemp_both


Hawaiian occupancy rates

Description

Quarterly Hawaiian hotel occupancy rate (percent of rooms occupied) from 1982-I to 2015-IV

Format

The format is: Time-Series [1:136] from 1982 to 2015: 79 65.9 70.9 66.7 ...

Source

https://dbedt.hawaii.gov/economic/qser/tourism/

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

tsplot(hor, type='c')                           # plot data and
text(hor, labels=1:4, col=c(1,4,2,6), cex=.9)   # add quarter labels

Johnson and Johnson Quarterly Earnings Per Share

Description

Johnson and Johnson quarterly earnings per share, 84 quarters (21 years) measured from the first quarter of 1960 to the last quarter of 1980.

Format

The format is: Time-Series [1:84] from 1960 to 1981: 0.71 0.63 0.85 0.44 0.61 0.69 0.92 0.55 0.72 0.77 ...

Details

The data were provided (personal communication) by Professor Paul Griffin, https://gsm.ucdavis.edu/profile/paul-griffin, of the Graduate School of Management, University of California, Davis. This data set is also included with the R distribution as JohnsonJohnson.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Lag Plot - one time series

Description

Produces a grid of scatterplots of a series versus lagged values of the series.

Usage

lag1.plot(series, max.lag = 1, corr = TRUE, smooth = TRUE, col = gray(.1), bg = NA, 
           lwl = 1, lwc = 2, bgl = NULL, ltcol = 1, box.col = NULL, cex = .9, 
           gg = FALSE, location="topright", xname = NULL, main = NULL, ...)

Arguments

series

the data

max.lag

maximum lag

corr

if TRUE, shows the autocorrelation value in a legend

smooth

if TRUE, adds a lowess fit to each scatterplot

col

color of points; default is gray(.1)

bg

background color for filled plot characters

lwl

width of lowess line; default is 1

lwc

color of lowess line; default is 2 (red)

bgl

background of the ACF legend; default is semitransparent

ltcol

legend text color; default is black

box.col

color of the border of the ACF legend; default matches type of plot

cex

size of points; default is .9

gg

if TRUE, will produce a gris-gris plot (gray graphic interior with white grid lines); the default is FALSE. The grammar of astsa is voodoo

location

the location of the ACF legend with options "bottomright", "bottom", "bottomleft", "left", "topleft", "top", "topright" (the default), "right" and "center".

xname

a string; name of the series to be used for axis labels. If NULL, the name of the series as input is used.

main

a string for the title if desired, otherwise there is no title.

...

additional graphical arguments

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lag2.plot, tspairs

Examples

lag1.plot(log(varve), max.lag=9, lwl=3, lwc=6, col=5, location='topleft')

lag1.plot(soi, 12, pch=19, col=astsa.col(4, .3), gg=TRUE)

lag1.plot(diff(log(varve)), 4, xname='V', col=6, cex=1.1, lwc=5, pch=5,
           main=bquote(V(t)==nabla*log(varve[t]))) 

Lag Plot - two time series

Description

Produces a grid of scatterplots of one series versus another lagged. The first named series is the one that gets lagged.

Usage

lag2.plot(series1, series2, max.lag = 0, corr = TRUE, smooth = TRUE, col = gray(.1), 
          bg = NA, lwl = 1, lwc = 2, bgl = NULL, ltcol = 1, box.col = NULL, cex = .9, 
          gg = FALSE, location="topright", xname=NULL, yname=NULL, main=NULL, ...)

Arguments

series1

first series (the one that gets lagged)

series2

second series

max.lag

maximum number of lags

corr

if TRUE, shows the cross-correlation value in a legend

smooth

if TRUE, adds a lowess fit to each scatterplot

col

color of points; default is gray(.1)

bg

background color for filled plot characters

lwl

width of lowess line; default is 1

lwc

color of lowess line; default is 2 (red)

bgl

background of the ACF legend; default is semitransparent

ltcol

legend text color; default is black

box.col

color of the border of the ACF legend; default matches type of plot

cex

size of points; default is .9

gg

if TRUE, will produce a gris-gris plot (gray graphic interior with white grid lines); the default is FALSE. The grammar of astsa is voodoo

location

the location of the CCF legend with options "bottomright", "bottom", "bottomleft", "left", "topleft", "top", "topright" (the default), "right" and "center".

xname, yname

strings for the names of the series to be used for axis labels. If NULL, the name of the series as input is used.

main

a string for the title if desired, otherwise there is no title.

...

additional graphical parameters

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lag1.plot, tspairs

Examples

lag2.plot(Hare, Lynx, max.lag=5, lwl=2, lwc=3, cex=1.5, pch=24, bg='orange')

lag2.plot(soi, rec, 8, cex=1.1, pch=19, col=5, lwl=2, location="bottomleft")

lag2.plot(diff(lead), diff(sales), 5, smooth=FALSE, gg=TRUE, pch=8, col=6, 
          xname='dL', yname='dS', main='BJ Sales')

LA Pollution-Mortality Study

Description

LA Pollution-Mortality Study (1970-1979), weekly data.

Format

The format is: mts [1:508, 1:11]

Details

columns are time series with names
(1) Total Mortality tmort
(2) Respiratory Mortality rmort
(3) Cardiovascular Mortality cmort
(4) Temperature tempr
(5) Relative Humidity rh
(6) Carbon Monoxide co
(7) Sulfur Dioxide so2
(8) Nitrogen Dioxide no2
(9) Hydrocarbons hycarb
(10) Ozone o3
(11) Particulates part

Note

Details may be found in http://www.sungpark.net/ShumwayAzariPawitan88.pdf

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lap.xts


LA Pollution-Mortality Study: Sampled Daily

Description

Original data from a study of the effects of pollution and weather on mortality, LA, 1970-1979. These are 3652 daily observations for the 10 year period. The data set is an 'xts' object indexed by Date.

Format

The format is: An xts object on 1970-01-01 / 1979-12-31 containing:
Data: double [3652, 11]
Columns: Tmort, Rmort, Cmort, Temp, Rhumid, CO, SO2, NO2, HC, Ozone, Part
Index: Date [3652] (TZ: "UTC")

Details

columns are time series with names
(1) Total Mortality Tmort
(2) Respiratory Mortality Rmort
(3) Cardiovascular Mortality Cmort
(4) Temperature Temp
(5) Relative Humidity Rhumid
(6) Carbon Monoxide CO
(7) Sulfur Dioxide SO2
(8) Nitrogen Dioxide NO2
(9) Hydrocarbons HC
(10) Ozone Ozone
(11) Particulates Part

Note

These are the original data from https://github.com/DSStoffer/dsstoffer.github.io/blob/main/files/LAP.pdf.

The weekly data in lap were taken from this data set last century. The details, however, were never entirely made clear and it's too late to get them now. It is easy to pull out the weekly averages from this data set, and how to do so is given in the Examples section below; the resulting data set will be slightly different than lap. The names for this data set are different from lap, the main difference is these names have capitals.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lap

Examples


# if 'xts' is not installed you can still do this
tsplot(timex(lap.xts), lap.xts, ncolm=3, col=astsa.col(4,wheel=TRUE,num=11), scale=.9)

# differencing (on its own) loses an obs 
dCmort = diff(log(lap.xts[,'Cmort']))
tsplot(timex(lap.xts)[-1], dCmort, col=4, gg=TRUE)

# classic IMA(1,1)
acf2(dCmort, col=2:7, lwd=4)

## Not run: 

library(xts)   # assumes package has been installed

plot(lap.xts$Cmort, col=4)   

lapw = apply.weekly(lap.xts, FUN=colMeans)  # get weekly averages

plot(lapw[,c('Cmort', 'Temp', 'Part')], col=astsa.col(2:4, .7), main=NA) 
addLegend(col=2:4, lty=1, lwd=2, ncol=3, bty="white")

sarima(lapw$Cmort, 0,1,1, no.constant=TRUE)  # fit ARIMA(0,1,1) to weekly Cmort

## End(Not run)

Leading Indicator

Description

Leading indicator, 150 months; taken from Box and Jenkins (1970).

Usage

data(lead)

Format

The format is: Time-Series [1:150] from 1 to 150: 10.01 10.07 10.32 9.75 10.33 ...

Details

This is also the R time series BJsales.lead: The sales time series BJsales and leading indicator BJsales.lead each contain 150 observations. The objects are of class "ts".

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

sales


Powers of a Square Matrix

Description

matrixpwr computes powers of a square matrix including negative powers for nonsingular matrices.

%^% is a more intuitive interface as an operator.

Usage

matrixpwr(A, power)

A %^% power

Arguments

A

a square matrix

power

single numeric

Details

Raises matrix to the specified power. The matrix must be square and if power < 0, the matrix must be nonsingular.

Note that %^% is defined as "%^%" <- function(A, power) matrixpwr(A, power)

If power = 0, the identity matrix is returned.

Value

Returns matrix raised to the given power.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

# 2-state Markov transition matrix 
( P = matrix(c(.7,.4,.3,.6), 2) )
# moving to steady state
P %^% 5
P %^% 10


# surround with parentheses if used in an expression
c(.2, .8) %*% (P %^% 50)

# Inverse square root
var(econ5) %^% -.5

Univariate and Multivariate Spectral Estimation

Description

This is spec.pgram with a number changes and written so you can easily extract the estimate of the multivariate spectral matrix as fxx. The bandwidth calculation has been changed to the more practical definition given in the text and this can be used to replace spec.pgram.

Usage

mvspec(x, spans = NULL, kernel = NULL, taper = 0, pad = 0, fast = TRUE, 
        demean = FALSE, detrend = TRUE, lowess = FALSE, log = 'n', plot = TRUE, 
        gg = FALSE, type = NULL, na.action = na.fail, nxm = 2, nym = 1, main = NULL, 
        xlab = NULL, cex.main = NULL, ci = .95, ci.col = 4, plot.type, report=TRUE, ...) 

Arguments

x

univariate or multivariate time series (i.e., the p columns of x are time series)

spans

vector of odd integers giving the widths of modified Daniell smoothers to be used to smooth the periodogram

kernel

alternatively, a kernel smoother of class tskernel

taper

specifies the proportion of data to taper using a split cosine bell taper (.5 specifies a full taper)

pad

proportion of data to pad (zeros are added to the end of the series to increase its length by the proportion pad)

fast

logical; if TRUE, pad the series to a highly composite length

demean

if TRUE, series is demeaned first

detrend

if TRUE, series is detrended first (unless demean is TRUE)

lowess

if TRUE and detrend TRUE (and demean FALSE), series is detrended using lowess first

log

if log='y', spectra plotted on a log scale; otherwise a log scale is not used

plot

plot the estimated spectra

gg

if TRUE, will produce a gris-gris plot (gray graphic interior with white grid lines); the default is FALSE. The grammar of astsa is voodoo

type

type of plot to be drawn, defaults to lines (see par)

na.action

how to handle missing values

nxm, nym

the number of minor tick mark divisions on x-axis, y-axis; the default is one minor tick on the x-axis and none on the y-axis

main

title of the graphics; if NULL (default), a totally awesome title is generated dude, but if NA there will be no gnarly title and the top margin will be used for the plot

xlab

label for frequency axis; if NULL (default), a totally awesome label is generated for your viewing pleasure

cex.main

magnification for main title; default is 1.

ci

confidence level if one is drawn.

ci.col

color of the confidence interval if one is drawn.

plot.type

plot type for multivariate time series; leave blank or specify 'marginal' if a marginal plot of the spectra is desired, or set plot.type='coh' for coherency plot(s), or plot.type='phase' for phase plot(s).

report

if TRUE (default), prints bandwidth, degrees of freedom, and amount of tapering to screen

...

additional graphical arguments.

Details

This is built off of spec.pgram from the stats package with a few changes in the defaults and written so you can easily extract the estimate of the multivariate spectral matrix as fxx.

The default for the plot is NOT to plot on a log scale and the graphic will have a grid. Overall, the graphics have been improved.

The bandwidth calculation has been changed to the more practical definition given in the text, (L_h/n.used)*frequency(x). Also, the bandwidth is not displayed in the graphic, but is returned.

Although initially meant to be used to easily obtain multivariate (mv) spectral (spec) estimates, this script can be used for univariate time series as a replacement for spec.pgram.

Note that the script does not taper by default (taper=0); this forces the user to do "conscious tapering".

In the multivariate case (more than 2 series), if "coherency" or "phase" plots are desired, the result is a grid of plots. There is a "scale" factor that can be set to prevent the labels from getting too small if there are many series. The default is scale=1, and to expand the labels by 10% for example, set scale=1.1. Also, if there are many series, having minor tick marks can make the graphic look crowded; in this case, set minor=FALSE. Finally, the plots include a type of legend that shows the axes with their corresponding labels (by default). To turn the legend off, include addLegend=FALSE in the call. Again, these considerations only work in the multivariate case (more than 2 series).

Value

All results are returned invisibly.

If plot is TRUE and smoothing is used, the bandwidth, degrees of freedom, and taper amount are printed.

An object of class "spec", which is a list containing at least the following components:

fxx

spectral matrix estimates; an array of dimensions dim = c(p,p,nfreq).

freq

vector of frequencies at which the spectral density is estimated.

spec

vector (for univariate series) or matrix (for multivariate series) of estimates of the spectral density at frequencies corresponding to freq.

details

matrix with columns: frequency, period, spectral ordinate(s)

coh

NULL for univariate series. For multivariate time series, a matrix containing the squared coherency between different series. Column i + (j - 1) * (j - 2)/2 of coh contains the squared coherency between columns i and j of x, where i < j.

phase

NULL for univariate series. For multivariate time series a matrix containing the cross-spectrum phase between different series. The format is the same as coh.

Lh

Number of frequencies (approximate) used in the band.

n.used

Sample length used for the FFT

df

Degrees of freedom (may be approximate) associated with the spectral estimate.

bandwidth

Bandwidth (may be approximate) associated with the spectral estimate.

method

The method used to calculate the spectrum.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

# real raw periodogram
mvspec(soi)
mvspec(soi, log='y')  # on a log scale

# smooth and some details printed
mvspec(soi, spans=c(7,7), taper=.1)$details[1:45,]

# bivariate example
deth = cbind(mdeaths, fdeaths)    # two R data sets, male/female monthly deaths ...
tsplot(deth, type='b', col=c(4,6), spaghetti=TRUE, pch=c('M','F'), addLegend=TRUE)
dog = mvspec(deth, spans=c(3,3), taper=.1)
dog$fxx[,,1:5]  # look at a few spectral matrix estimates
dog$bandwidth   # bandwidth with time unit = year
dog$df          # degrees of freedom
mvspec(deth, spans=c(3,3), taper=.1, plot.type='coh')  # coherence

# multivariate example
mvspec(diff(log(econ5)), spans=c(5,5), col=5, lwd=2, ci=NA, gg=TRUE, minor=FALSE, 
         plot.type='coh')   

mvspec(diff(log(econ5)), spans=c(5,5), col=5, lwd=2, ci=NA, gg=TRUE, minor=FALSE, 
         plot.type='coh', addLegend=FALSE)   

Returns of the New York Stock Exchange

Description

Returns of the New York Stock Exchange (NYSE) from February 2, 1984 to December 31, 1991.

Format

The format is: Time-Series [1:2000] from 1 to 2000: 0.00335 -0.01418 -0.01673 0.00229 -0.01692 ...

Note

Various packages have data sets called nyse. Consequently, it may be best to specify this data set as nyse = astsa::nyse to avoid conflicts.

Source

Most likely from the S+GARCH module - Version 1.1 Release 2: 1998

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Crude oil, WTI spot price FOB

Description

Crude oil, WTI spot price FOB (in dollars per barrel), weekly data from 2000 to mid-2010.

Format

The format is: Time-Series [1:545] from 2000 to 2010: 26.2 26.1 26.3 24.9 26.3 ...

Details

pairs with the series gas

Source

Data were obtained from the URL: www.eia.doe.gov/dnav/pet/pet_pri_spt_s1_w.htm

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

gas

Examples

tsplot(cbind(gas,oil), spag=TRUE, col=2*1:2, addLegend=TRUE)


Particulate levels from the LA pollution study

Description

Particulate series corresponding to cmort from the LA pollution study.

Format

The format is: Time-Series [1:508] from 1970 to 1980: 72.7 49.6 55.7 55.2 66 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lap, lap.xts


Poliomyelitis cases in US

Description

Monthly time series of poliomyelitis cases reported to the U.S. Centers for Disease Control for the years 1970 to 1983, 168 observations.

Format

The format is: Time-Series [1:168] from 1970 to 1984: 0 1 0 0 1 3 9 2 3 5 ...

Details

The data were originally modelled by Zeger (1988) “A Regression Model for Time Series of Counts,” Biometrika, 75, 822-835.

Source

Data taken from the gamlss.data package; see https://www.gamlss.com/.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

tsplot(polio, type='s')

Multiplication of Two Polynomials

Description

Multiplication of two polynomials.

Usage

polyMul(p, q)

Arguments

p

coefficients of first polynomial

q

coefficients of second polynomial

Details

inputs are vectors of coefficients a, b, c, ..., in order of power ax^0 + bx^1 + cx^2 + ...

Value

coefficients of the product in order of power

Author(s)

D.S. Stoffer

Source

based on code from the polynom package https://CRAN.R-project.org/package=polynom

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

a = 1:3  # 1 + 2x + 3x^2
b = 1:2  # 1 + 2x
polyMul(a, b)
# 1 + 4x + 7x^2 + 6x^3

Cross-Correlation Analysis With Automatic Prewhitening

Description

Performs a cross-correlation analysis on two series after prewhitening the first series and filtering the second series accordingly.

Usage

pre.white(series1, series2, diff = FALSE, max.lag = NULL, main = NULL, 
           order.max = NULL, plot = TRUE, ...)

Arguments

series1, series2

univariate time series

diff

(logical or integer) should the series be differenced prior to the analysis and if more than first order, by how much

max.lag

maximum lag for which to plot the CCF - if NULL, a suitable number is chosen (see details)

main

plot title - if NULL, uses series1 name appended by .w for whitened and series2 name appended by .f for filtered

order.max

maximum order of model to fit (see details)

plot

should the sample CCF be plotted

...

additional graphic arguments

Details

The first series is prewhitened by fitting a long AR based on AIC and the second series is filtered appropriately. Then a cross-correlation analysis is performed via ccf2. If differencing is specified, both series are differenced the same way prior to the prewhitening. The resulting series are returned invisibly.

The default is no differencing. Differences of order 1 can be set be entering diff = TRUE or diff = 1. If it is necessary to use higher orders, then enter a positive integer (this is rare).

The maximum lag (max.lag) in the CCF graphic defaults (if NULL) to the smaller of 50 and 20% of the sample size.

The maximum order (order.max) for fitting the AR via AIC defaults (if NULL) to the minimum of 30 and 15% of the number of observations.

Value

Returns the sample CCF graphic using the prewhitened series unless plot = FALSE. The prewhitened series are returned invisibly.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

pre.white(cmort, part, diff=TRUE, col=4)

Monthly Federal Reserve Board Production Index

Description

Monthly Federal Reserve Board Production Index (1948-1978, n = 372 months).

Usage

data(prodn)

Format

The format is: Time-Series [1:372] from 1948 to 1979: 40.6 41.1 40.5 40.1 40.4 41.2 39.3 41.6 42.3 43.2 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Quarterly Inflation

Description

Quarterly inflation rate in the Consumer Price Index from 1953-Ito 1980-II, n = 110 observations.

Format

The format is: Time-Series [1:110] from 1953 to 1980: 1.673 3.173 0.492 -0.327 -0.333 ...

Details

pairs with qintr (interest rate)

Source

Newbold, P. and T. Bos (1985). Stochastic Parameter Regression Models. Beverly Hills: Sage.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

qintr


Quarterly Interest Rate

Description

Quarterly interest rate recorded for Treasury bills from 1953-Ito 1980-II, n = 110 observations.

Format

The format is: Time-Series [1:110] from 1953 to 1980: 1.98 2.15 1.96 1.47 1.06 ...

Details

pairs with qinfl (inflation)

Source

Newbold, P. and T. Bos (1985). Stochastic Parameter Regression Models. Beverly Hills: Sage.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

qinfl


Recruitment (number of new fish index)

Description

Recruitment (index of the number of new fish) for a period of 453 months ranging over the years 1950-1987. Recruitment is loosely defined as an indicator of new members of a population to the first life stage at which natural mortality stabilizes near adult levels.

Usage

data(rec)

Format

The format is: Time-Series [1:453] from 1950 to 1988: 68.6 68.6 68.6 68.6 68.6 ...

Details

can pair with soi (Southern Oscillation Index)

Source

Data furnished by Dr. Roy Mendelssohn of the Pacific Fisheries Environmental Laboratory, NOAA (personal communication). Further discussion of the concept of Recruitment may be found here: derekogle.com/fishR/examples/oldFishRVignettes/StockRecruit.pdf

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

soi


Sales

Description

Sales, 150 months; taken from Box and Jenkins (1970).

Format

The format is: Time-Series [1:150] from 1 to 150: 200 200 199 199 199 ...

Details

This is also the R data set BJsales: The sales time series BJsales and leading indicator BJsales.lead each contain 150 observations. The objects are of class "ts".

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lead


Monthly export price of salmon

Description

Farm Bred Norwegian Salmon, export price, US Dollars per Kilogram

Format

The format is: Time-Series [1:166] from September 2003 to June 2017: 2.88 3.16 2.96 3.12 3.23 3.32 3.45 3.61 3.48 3.21 ...

Source

https://www.indexmundi.com/commodities/

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Salt Profiles

Description

Salt profiles taken over a spatial grid set out on an agricultural field, 64 rows at 17-ft spacing.

Usage

data(salt)

Format

The format is: Time-Series [1:64] from 1 to 64: 6 6 6 3 3 3 4 4 4 1.5 ...

Details

pairs with saltemp, temperature profiles on the same grid

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

saltemp


Temperature Profiles

Description

Temperature profiles over a spatial grid set out on an agricultural field, 64 rows at 17-ft spacing.

Usage

data(saltemp)

Format

The format is: Time-Series [1:64] from 1 to 64: 5.98 6.54 6.78 6.34 6.96 6.51 6.72 7.44 7.74 6.85 ...

Details

pairs with salt, salt profiles on the same grid

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

salt


Fit ARIMA Models

Description

Fits ARIMA models (with diagnostics) in a short command. It can also be used to perform regression with autocorrelated errors.

Usage

sarima(xdata, p, d, q, P = 0, D = 0, Q = 0, S = -1, 
       details = TRUE, xreg = NULL, Model = TRUE,
       fixed = NULL, tol = sqrt(.Machine$double.eps), 
       no.constant = FALSE, col, fitdf, ...)

Arguments

xdata

univariate time series

p

AR order

d

difference order

q

MA order

P

SAR order; use only for seasonal models

D

seasonal difference; use only for seasonal models

Q

SMA order; use only for seasonal models

S

seasonal period; use only for seasonal models

details

if FALSE, turns off the diagnostic plot and the output from the nonlinear optimization routine, which is optim. The default is TRUE.

xreg

Optionally, a vector or matrix of external regressors, which must have the same number of rows as xdata.

Model

if TRUE (default), the model orders are printed on the diagnostic plot.

fixed

optional numeric vector of the same length as the total number of parameters. If supplied, only parameters corresponding to NA entries will be estimated.

tol

controls the relative tolerance (reltol in optim) used to assess convergence. The default is sqrt(.Machine$double.eps), the R default.

no.constant

controls whether or not sarima includes a constant in the model. In particular, if there is no differencing (d = 0 and D = 0) you get the mean estimate. If there is differencing of order one (either d = 1 or D = 1, but not both), a constant term is included in the model. These two conditions may be overridden (i.e., no constant will be included in the model) by setting this to TRUE; e.g., sarima(x,1,1,0,no.constant=TRUE). Otherwise, no constant or mean term is included in the model. If regressors are included (via xreg), this is ignored.

col

color of diagnostic plots; default is 1 (black)

fitdf

number of degrees of freedom to be subtracted for the Ljung-Box test if xdata is a series of residuals and all orders are zero (see details). Does not have to be specified if it is zero (0).

...

additional graphical arguments

Details

If your time series is in x and you want to fit an ARIMA(p,d,q) model to the data, the basic call is sarima(x,p,d,q). As of version 2.3, the orders do not have to be specified if they are zero. For example, sarima(x, p=1) is the same as sarima(x,1,0,0).

To fit a seasonal ARIMA model, the basic call is sarima(x,p,d,q,P,D,Q,S). For example, sarima(x, 2,1,0, 0,1,1,12) will fit a seasonal ARIMA(2,1,0) \times (0,1,1)_{12} model to the series in x. The orders do not have to be specified if they are zero; e.g., sarima(x, d=1,q=1, D=1,Q=1,S=4) works.

The results are the parameter estimates, standard errors, AIC, AICc, BIC and diagnostics. The difference between the information criteria given by sarima() and arima() is that they differ by a scaling factor of the effective sample size.

The script may be used for a residual analysis by running it without specifying any orders. In this case, it may be necessary to specify fitdf to get the correct degrees of freedom such as in fitting a state space model.

Value

A t-table, the estimated noise variance, and AIC, AICc, BIC are printed. The following are returned invisibly as a list:

fit

[[1]] an object of class Arima with more information than you need

sigma2

[[2]] the estimate of the noise variance

degrees_of_freedom

[[3]] error degrees of freedom

t.table

[[4]] a little t-table with two-sided p-values

ICs

[[5]] AIC - AICc - BIC

Missing Data

Yes it's ok if input as NA and the observations are vector or ts objects (meaning equally spaced).

Source

This is an enhancement of arima from the stats package.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

sarima.for, sarima.sim

Examples


# easy to use 
sarima(rec, 2,0,0)  # data, p, d, and q

# redux - minimal output
sarima(rec, p=2, details=FALSE)

# fun for the whole family
dog = sarima(log(AirPassengers), 0,1,1, 0,1,1,12, details=FALSE)
# dog[[1]] has most of the results ...
tsplot(resid(dog[[1]]))

# fixed parameters
x = sarima.sim( ar=c(0,-.9), n=200 ) + 50 
sarima(x, p=2, fixed=c(0,NA,NA))  # phi1 fixed, phi2 and mean free

# regression with autocorrelated errors  
sarima(log(cpg), p=1, xreg=time(cpg))

# missing data (color, gris-gris, and pch, added for fun)
sarima(ar1miss, p=1, col=4, gg=TRUE, pch=19)


ARIMA Forecasting

Description

ARIMA forecasting.

Usage

sarima.for(xdata, n.ahead, p, d, q, P=0, D=0, Q=0, S=-1, tol = sqrt(.Machine$double.eps),
         no.constant = FALSE, plot = TRUE, plot.all = FALSE,  ylab = NULL, xreg = NULL, 
         newxreg = NULL, fixed = NULL, pcol = 2, pch = 1, ...)

Arguments

xdata

univariate time series

n.ahead

forecast horizon (number of periods)

p

AR order

d

difference order

q

MA order

P

SAR order; use only for seasonal models

D

seasonal difference; use only for seasonal models

Q

SMA order; use only for seasonal models

S

seasonal period; use only for seasonal models

tol

controls the relative tolerance (reltol) used to assess convergence. The default is sqrt(.Machine$double.eps), the R default.

no.constant

controls whether or not a constant is included in the model. If no.constant=TRUE, no constant is included in the model. See sarima for more details.

plot

if TRUE (default) the data (or some of it) and the forecasts and bounds are plotted

plot.all

if TRUE, all the data are plotted in the graphic; otherwise, only the last 100 observations are plotted in the graphic.

ylab

if NULL (default), the y-axis label is the name of the series.

xreg

Optionally, a vector or matrix of external regressors, which must have the same number of rows as the series. If this is used, newxreg MUST be specified.

newxreg

New values of xreg to be used for prediction. Must have at least n.ahead rows.

fixed

optional numeric vector of the same length as the total number of parameters. If supplied, only parameters corresponding to NA entries will be estimated.

pcol

color of the predictions in the graphic.

pch

plot character for the graphic. If plot.all=TRUE, this only applies to the forecasts.

...

additional graphical arguments

Details

For example, sarima.for(x, 5, 1,0,1) or sarima.for(x, 5, p=1, q=1) will forecast five time points ahead for an ARMA(1,1) fit to x. The output prints the forecasts and the standard errors of the forecasts, and supplies a graphic of the forecast with +/- 1 and 2 prediction error bounds.

Value

pred

the forecasts

se

the prediction (standard) errors

Missing Data

Yes it's ok if input as NA and the observations are vector or ts objects (meaning equally spaced). In this case, the graphic includes a line with points. Otherwise, lone observations would not be visible.

Note

If plot.all=TRUE, the data are displayed as a line only unless there are missing observations; see the Missing Data section. Points (and more) can be added to the graphic as long as the device stays open. For example:

sarima.for(gtemp_land, 10, d=1, q=1, plot.all=TRUE, pch=19)
points(gtemp_land, pch=20, col=4)
abline(v=2024, col=6, lty=5)
text(2000, 2.2, "it's getting hot in here", font=2, col=6, srt=45)

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

sarima

Examples


sarima.for(gtemp_both, n.ahead=6, d=1, q=1, col=6, pcol=4, gg=TRUE)

# with regressors 
nummy   = length(soi)
n.ahead = 24 
nureg   = time(soi)[nummy] + seq(1,n.ahead)/12
sarima.for(soi, n.ahead, 2,0,0, 2,0,0,12, xreg=time(soi), newxreg=nureg) 

# missing data
sarima.for(ar1miss, n.ahead=5, p=1, pch=19)

ARIMA Simulation

Description

Simulate data from (seasonal) ARIMA models.

Usage

sarima.sim(ar = NULL, d = 0, ma = NULL, sar = NULL, D = 0, sma = NULL, S = NULL, 
           n = 500, rand.gen = rnorm, innov = NULL, burnin = NA, t0 = 0, red.tol=.1, ...)

Arguments

ar

coefficients of AR component (does not have to be specified)

d

order of regular difference (does not have to be specified)

ma

coefficients of MA component (does not have to be specified)

sar

coefficients of SAR component (does not have to be specified)

D

order of seasonal difference (does not have to be specified)

sma

coefficients of SMA component (does not have to be specified)

S

seasonal period (does not have to be specified)

n

desired sample size (defaults to 500)

rand.gen

optional; a function to generate the innovations (defaults to normal)

innov

an optional times series of innovations. If not provided, rand.gen is used.

burnin

length of burn-in (a non-negative integer). If NA, or not a positive integer, or a vector, a reasonable value is selected.

t0

start time (defaults to 0)

red.tol

tolerance for reporting parameter redundancy (default is .1 - set to 0 to avoid check)

...

additional arguments applied to the innovations. For rand.gen, the standard deviation of the innovations generated by rnorm can be specified by sd or the mean by mean (see details and examples). In addition, rand.gen may be overridden using a preset sequence of innovations specifying innov (see details and examples).

Details

Will generate a time series of length n from the specified SARIMA model using simplified input.

The use of the term mean under the '...' argument refers to the generation of normal innovations. For example, sarima.sim(ar=.9, mean=5) will generate data using N(5,1) or 5+N(0,1) innovations, so that the constant in the model is 5 and the mean of the AR model is 5/(1-.9) = 50. In sarima.sim(ma=.9, mean=5), however, the model mean is 5 (the constant). Also, a random walk with drift = .1 can be generated by sarima.sim(d=1, mean=.1, burnin=0), which is equivalent to cumsum(rnorm(500, mean=.1)). The same story goes if sd is specified; i.e., it's applied to the innovations. Because anything specified in ... refers to the innovations, a simpler way to generate a non-zero mean is to add the value outside the call; see the examples.

If innov is used to input the innovations and override rand.gen, be sure that length(innov) is at least n + burnin. If the criterion is not met, the script will return less than the desired number of values and a warning will be given.

Value

A time series of length n from the specified SARIMA model with the specified frequency if the model is seasonal and start time t0.

Note

The model autoregressive polynomial ('AR side' = AR x SAR) is checked for causality and the model moving average polynomial ('MA side' = MA x SMA) is checked invertibility. The script stops and reports an error at the first violation of causality or invertibility; i.e., it will not report multiple errors.

Overparameterization is also checked. To evaluate parameter redundancy, the inverse roots of the (S)AR and (S)MA polynomials are examined for closeness with red.tol determining closeness. This can be shut off by setting red.tol=0.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

## AR(2) with mean 50 [n = 500 is default]
y = sarima.sim(ar=c(1.5,-.75)) + 50
tsplot(y)

## ARIMA(0,1,1) with drift ['mean' refers to the innovations] 
tsplot(sarima.sim(ma=-.8, d=1, mean=.25))

## Overparameterized White Noise
tsplot(sarima.sim(ar=.9, ma=-.9))

## SAR(1) example from text
set.seed(10101010)
x = sarima.sim(sar=.95, S=12, n=37) + 5
tsplot(x, type='c')
points(x, pch=Months, cex=1.5, font=2, col=1:12)

## SARIMA(0,1,1)x(0,1,1)_12 - B&J's favorite
set.seed(101010)
tsplot(sarima.sim(d=1, ma=-.4, D=1, sma=-.6, S=12, n=120))  

## infinite variance t-errors 
tsplot(sarima.sim(ar=.9, rand.gen=function(n, ...) rt(n, df=2) ))

## use your own innovations
dog = rexp(150, rate=.5)*sign(runif(150,-1,1))
tsplot(sarima.sim(n=100, ar=.99, innov=dog, burnin=50))

## generate seasonal data but no P, D or Q - you will receive 
## a message to make sure that you wanted to do this on purpose: 
tsplot(sarima.sim(ar=c(1.5,-.75), n=144, S=12), ylab='doggy', xaxt='n')
mtext(seq(0,144,12), side=1, line=.5, at=0:12)


Scatterplot with Marginal Histograms

Description

Draws a scatterplot with histograms in the margins.

Usage

scatter.hist(x, y, xlab = NULL, ylab = NULL, title = NULL, pt.size = 1, 
              hist.col = gray(0.82), pt.col = gray(0.1, 0.25), pch = 19, 
              reset.par = TRUE, ...)

Arguments

x

vector of x-values

y

corresponding vector of y-values

xlab

x-axis label (defaults to name of x)

ylab

y-axis label (defaults to name of y)

title

plot title (optional)

pt.size

size of points in scatterplot

hist.col

color for histograms

pt.col

color of points in scatterplot

pch

scatterplot point character

reset.par

reset graphics - default is TRUE; set to FALSE to add on to scatterplot

...

addtional graphical parameters sent to Grid

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

scatter.hist(tempr, cmort, hist.col=astsa.col(5,.4), pt.col=5, pt.size=1.5, reset=FALSE)
lines(lowess(tempr, cmort), col=6)


scatter.hist(diff(log(econ5[,'gnp'])), diff(log(econ5[,'unemp'])), nxm=5, pt.size=2, 
    col=astsa.col(6,.1), pt.col=astsa.col(4, alpha=.6, wheel=TRUE, num=25), hist='green3')


Sleep State and Movement Data - Group 1

Description

Sleep-state and number of movements of infants taken from a study on the effects of prenatal exposure to alcohol. This is Group 1 where the mothers did not drink alcohol during pregnancy.

Format

List of 12 (by subjects) :'data.frame': 120 obs. of 3 variables: .. min : int [1:120] minute (1 to 120) .. state: int [1:120] sleep state 1 to 6 with NA missing (see details) .. mvmnt: int [1:120] number of movements

Details

Per minute sleep state, for approximately 120 minutes, is categorized into one of six possible states, non-REM: NR1 [1] to NR4 [4], and REM [5], or AWAKE [6]. NA means no state is recorded for that minute (if there, it occurs at end of the session). Group 1 (this group) is from mothers who abstained from drinking during pregnancy. In addition, the number of movements per minute are listed.

Source

Stoffer, D. S., Scher, M. S., Richardson, G. A., Day, N. L., Coble, P. A. (1988). A Walsh-Fourier Analysis of the Effects of Moderate Maternal Alcohol Consumption on Neonatal Sleep-State Cycling. Journal of the American Statistical Association, 83(404), 954-963. https://doi.org/10.2307/2290119

Stoffer, D. S. (1990). Multivariate Walsh-Fourier Analysis. Journal of Time Series Analysis, 11(1), 57-73. https://doi.org/10.1111/j.1467-9892.1990.tb00042.x

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

sleep2

Examples

# spectral analysis
x = dna2vector(sleep1[[1]]$state, alphabet=c('1','2','3','4','5'))  # never awake
specenv(na.omit(x), spans=c(3,3), col=5)  # not all babies make it to 120 minutes
abline(v=1/60, lty=2, col=8)
mtext(side=1, '1/60', at=1/60, cex=.75)


Sleep State and Movement Data - Group 2

Description

Sleep-state and number of movements of infants taken from a study on the effects of prenatal exposure to alcohol. This is Group 2 where the mothers drank alcohol in moderation during pregnancy.

Format

List of 12 (by subjects) :'data.frame': 120 obs. of 3 variables: .. min : int [1:120] minute (1 to 120) .. state: int [1:120] sleep state 1 to 6 with NA missing (see details) .. mvmnt: int [1:120] number of movements

Details

Per minute sleep state, for approximately 120 minutes, is categorized into one of six possible states, non-REM: NR1 [1] to NR4 [4], and REM [5], or AWAKE [6]. NA means no state is recorded for that minute (if there, it occurs at end of the session). Group 2 (this group) is from mothers who drank alcohol in moderation during pregnancy. In addition, the number of movements per minute are listed.

Source

Stoffer, D. S., Scher, M. S., Richardson, G. A., Day, N. L., Coble, P. A. (1988). A Walsh-Fourier Analysis of the Effects of Moderate Maternal Alcohol Consumption on Neonatal Sleep-State Cycling. Journal of the American Statistical Association, 83(404), 954-963. https://doi.org/10.2307/2290119

Stoffer, D. S. (1990). Multivariate Walsh-Fourier Analysis. Journal of Time Series Analysis, 11(1), 57-73. https://doi.org/10.1111/j.1467-9892.1990.tb00042.x

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

sleep1

Examples

tsplot(sleep2[[1]][,1], sleep2[[1]][,2:3], type='s', col=2*2:3, xlab='minute')
title('Baby Goo from Group 2', outer=TRUE, line=-1, cex.main=1)


SO2 levels from the LA pollution study

Description

Sulfur dioxide levels from the LA pollution study

Format

The format is: Time-Series [1:508] from 1970 to 1980: 3.37 2.59 3.29 3.04 3.39 2.57 2.35 3.38 1.5 2.56 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lap


Southern Oscillation Index

Description

Southern Oscillation Index (SOI) for a period of 453 months ranging over the years 1950-1987.

Format

The format is: Time-Series [1:453] from 1950 to 1988: 0.377 0.246 0.311 0.104 -0.016 0.235 0.137 0.191 -0.016 0.29 ...

Details

pairs with rec (Recruitment)

Source

Data furnished by Dr. Roy Mendelssohn of the Pacific Fisheries Environmental Laboratory, NOAA (personal communication).

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

rec, ENSO, MEI, MEI2


Spatial Grid of Surface Soil Temperatures

Description

A 64 by 36 matrix of surface soil temperatures ({}^\circ \text{C}).

Format

The format is: num [1:64, 1:36] 6.7 8.9 5 6.6 6.1 7 6.5 8.2 6.7 6.6 ...

Source

Bazza, M., Shumway, R. H., & Nielsen, D. R. (1988). Two-dimensional spectral analysis of soil surface temperature. Hilgardia: A Journal of Agricultural Science, 56, 1-28.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

par(mar = rep(1,4))
persp(1:64, 1:36, soiltemp, phi=25, theta=25, scale=FALSE, expand=4, 
       col='lightblue', border=4, ticktype="detailed", xlab="rows", 
       ylab="columns", zlab="temperature")

Returns of the S&P 500

Description

Daily growth rate of the S&P 500 from 2001 though 2011.

Format

The format is: Time Series; Start = c(2001, 2); End = c(2011, 209); Frequency = 252

Source

Douc, Moulines, & Stoffer (2014). Nonlinear Time Series: Theory, Methods and Applications with R Examples. CRC Press. doi:10.1201/b16331.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Weekly Growth Rate of the Standard and Poor's 500

Description

Weekly closing returns of the SP 500 from 2003 to September, 2012.

Format

An 'xts' object on 2003-01-03 to 2012-09-28; Indexed by objects of class: [Date] TZ: UTC

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples


# if 'xts' is not loaded, you can do this
par(mfrow=2:1)
tsplot(sp500w, col=4, lwd=2)                 # no dates
tsplot(timex(sp500w), sp500w, col=4, lwd=2)  # dates


Estimate Spectral Density of a Time Series from AR Fit

Description

Fits an AR model to data and computes (and by default plots) the spectral density of the fitted model based on AIC (default) or BIC.

Usage

spec.ic(xdata, BIC=FALSE, order.max=NULL, main=NULL, plot=TRUE, detrend=TRUE, 
         lowess=FALSE, method=NULL, cex.main=NULL, xlab=NULL, ...)

Arguments

xdata

a univariate time series.

BIC

if TRUE, fit is based on BIC. If FALSE (default), fit is based on AIC.

order.max

maximum order of model to fit. Defaults (if NULL) to the minimum of 100 and 10% of the number of observations.

main

plot title. Defaults to name of series, method and chosen order.

plot

if TRUE (default) produces a graphic of the estimated AR spectrum.

detrend

if TRUE (default), detrends the data first. If FALSE, the series is demeaned.

lowess

if TRUE, detrends using lowess. Default is FALSE.

method

method of estimation - a character string specifying the method to fit the model chosen from the following: "yule-walker", "burg", "ols", "mle", "yw". Defaults to "yule-walker".

cex.main

magnification for main title; default is 1.

xlab

label for frequency axis; if NULL (default), a totally awesome label is generated for your viewing pleasure.

...

additional graphical arguments.

Details

Uses ar to fit the best AR model based on pseudo AIC or BIC. Using method='mle' will be slow. The minimum centered AIC and BIC values and the spectral and frequency ordinates are returned silently.

Value

[[1]]

Matrix with columns: ORDER, AIC, BIC

[[2]]

Matrix with columns: freq, spec

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

ar, spec.ar

Examples


# AIC
dog <- spec.ic(soi)  # put results in dog

# plot AIC and BIC 
tsplot(dog[[1]][,2:3], col=2*1:2, type='o', pch=1:2, xlab='order',
        spag=TRUE, addLegend=TRUE)  


Spectral Envelope

Description

Computes the spectral envelope of categorical-valued or real-valued time series.

Usage

specenv(xdata, section = NULL, spans = NULL, kernel = NULL, taper = 0,
         significance = 1e-04, plot = TRUE, ylim = NULL, real = FALSE, ...)

Arguments

xdata

For categorical-valued sequences, a matrix with rows that are indicators of the categories represented by the columns, possibly a sequence converted using dna2vector. For real-valued sequences, a matrix with at least two columns that are various transformations of the data.

section

of the form start:end where start < end are positive integers; specifies the section used in the analysis - default is the entire sequence.

spans

specify smoothing used in mvspec.

kernel

specify kernel to be used in mvspec.

taper

specify amount of tapering to be used in mvspec.

significance

significance threshold exhibited in plot - default is .0001; set to NA to cancel

plot

if TRUE (default) a graphic of the spectral envelope is produced

ylim

limits of the spectral envelope axis; if NULL (default), a suitable range is calculated.

real

FALSE (default) for categorical-valued sequences and TRUE for real-valued sequences.

...

other graphical parameters.

Details

Calculates the spectral envelope for categorical-valued series as discussed in
https://www.stat.pitt.edu/stoffer/dss_files/spenv.pdf
and summarized in
https://doi.org/10.1214/ss/1009212816.
Alternately, calculates the spectral envelope for real-valued series as discussed in
https://doi.org/10.1016/S0378-3758(96)00044-4.

These concepts are also presented (with examples) in Section 7.9 (Chapter 7) of Time Series Analysis and Its Applications: With R Examples: https://www.stat.pitt.edu/stoffer/tsa4/.

For categorical-valued series, the input xdata must be a matrix of indicators which is perhaps a sequence preprocessed using dna2vector.

For real-valued series, the input xdata should be a matrix whose columns are various transformations of the univariate series.

The script does not detrend the data prior to estimating spectra. If this is an issue, then detrend the data prior to using this script.

Value

By default, will produce a graph of the spectral envelope and an approximate significance threshold. A matrix containing: frequency, spectral envelope ordinates, and (1) the scalings of the categories in the order of the categories in the alphabet or (2) the coefficients of the transformations, is returned invisibly.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

dna2vector

Examples

# a DNA sequence
data  = bnrf1ebv
xdata = dna2vector(data)
u = specenv(xdata, section=1:1000, spans=c(7,7))
head(u)  # scalings are for A, C, G, and last one T=0 always

# a real-valued series
x     = astsa::nyse
xdata = cbind(x, abs(x), x^2)
u     = specenv(xdata, real=TRUE, spans=c(3,3))
# plot optimal transform at freq = .001
beta  = u[2, 3:5]
( b   = beta/beta[2] )  # makes abs(x) coef=1
gopt  = function(z) { b[1]*z + b[2]*abs(z) + b[3]*z^2 }
gabs  = function(z) { abs(z) } 
z     = -20:20/100
tsplot(z, cbind(gopt(z), gabs(z)), spag=TRUE, col=5:6, addLegend=TRUE, lwd=2, 
        xlab='return', legend = c('optimal','absolute value' ), gg=TRUE)
title('transformations')

Speech Recording

Description

A small .1 second (1000 points) sample of recorded speech for the phrase "aaa...hhh".

Format

The format is: Time-Series [1:1020] from 1 to 1020: 1814 1556 1442 1416 1352 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


State Space Model

Description

Fits a simple univariate state space model to data. The parameters are estimated (the state regression parameter may be fixed). State predictions, filters, and smoothers and corresponding error variances are evaluated at the estimates. The sample size must be at least 20.

Usage

ssm(y, A, phi, alpha, sigw, sigv, fixphi = FALSE)

Arguments

y

data

A

measurement value (fixed constant)

phi

initial value of phi, may be fixed

alpha

initial value for alpha

sigw

initial value for sigma[w]

sigv

initial value for sigma[v]

fixphi

if TRUE, the phi parameter is fixed

Details

The script works for a specific univariate state space model,

x_t = \alpha + \phi x_{t-1} + w_t \quad {\rm and} \quad y_t = A x_t + v_t.

The initial state conditions use a default calculation and cannot be specified. The parameter estimates are printed and the script returns the state predictors and smoothers. The regression parameter \phi may be fixed.

Value

At the MLEs, these are returned invisibly:

Xp

time series - state prediction, x_t^{t-1}

Pp

corresponding MSPEs, P_t^{t-1}

Xf

time series - state filter, x_t^t

Pf

corresponding MSEs, P_t^t

Xs

time series - state smoother, x_t^n

Ps

corresponding MSEs, P_t^n

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

## Not run: 

u = ssm(gtemp_land, A=1, alpha=.01, phi=1, sigw=.05, sigv=.15, fixphi=TRUE)
tsplot(gtemp_land, type='o', col=4)
lines(u$Xs, col=6, lwd=2)

## End(Not run)

Variable Star

Description

The magnitude of a star taken at midnight for 600 consecutive days.

Format

The format is: Time-Series [1:600] from 1 to 600: 25 28 31 32 33 33 32 ...

Source

The data are taken from the classic text, The Calculus of Observations, a Treatise on Numerical Mathematics, by E.T. Whittaker and G. Robinson, (1923, Blackie and Son, Ltd.).

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Frequency Domain Stochastic Regression

Description

Performs frequency domain stochastic regression discussed in Chapter 7.

Usage

stoch.reg(xdata, cols.full, cols.red=NULL, alpha, L, M, plot.which, col.resp=NULL, ...)

Arguments

xdata

data matrix with the last column being the response variable

cols.full

specify columns of data matrix that are in the full model

cols.red

specify columns of data matrix that are in the reduced model (use NULL if there are no inputs in the reduced model)

alpha

test size; number between 0 and 1

L

odd integer specifying degree of smoothing

M

number (integer) of points in the discretization of the integral

plot.which

coh or F.stat, to plot either the squared-coherencies or the F-statistics, respectively

col.resp

specify column of the response variable if it is not the last column of the data matrix

...

additional graphic arguments

Details

This function computes the spectral matrix, F statistics and coherences, and plots them. Returned as well are the coefficients in the impulse response function.

Enter, as the argument to this function, the full data matrix, and then the labels of the columns of input series in the "full" and "reduced" regression models - enter NULL if there are no inputs under the reduced model.

If the response variable is the LAST column of the data matrix, it need not be specified. Otherwise specify which column holds the responses as col.resp.

Other inputs are alpha (test size), L (smoothing), M (number of points in the discretization of the integral) and plot.which = "coh" or "F", to plot either the coherences or the F statistics.

Value

power.full

spectrum under the full model

power.red

spectrum under the reduced model

Betahat

regression parameter estimates

eF

pointwise (by frequency) F-tests

coh

coherency

Note

See Example 7.1 of the text. The script is based on code that was contributed by Professor Doug Wiens, Department of Mathematical and Statistical Sciences, University of Alberta.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Biannual Sunspot Numbers

Description

Biannual smoothed (12-month moving average) number of sunspots from June 1749 to December 1978; n = 459.

Format

The format is: Time Series: Start = c(1749, 1) End = c(1978, 1) Frequency = 2

Note

The "z" on the end of sunspotz is to distinguish this series from the ones included with R (see sunspots).

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.


Temperatures from the LA pollution study

Description

Temperature series corresponding to cmort from the LA pollution study.

Format

The format is: Time-Series [1:508] from 1970 to 1980: 72.4 67.2 62.9 72.5 74.2 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lap, lap.xts


Test Linearity of a Time Series via Normalized Bispectrum

Description

Produces a plot of the tail probabilities of a normalized bispectrum of a series under the assumption the model is a linear process with iid innovations.

Usage

test.linear(series, color = TRUE, detrend = FALSE, main = NULL)

Arguments

series

the time series (univariate only)

color

if FALSE, the graphic is produced in gray scale

detrend

if TRUE, the series is detrended first

main

if NULL (default), a very nice title is chosen for the plot

Value

prob

matrix of tail probabilities - returned invisibly

Note

The null hypothesis is that the data are from a linear process with i.i.d. innovations. Under the null hypothesis, the bispectrum is constant over all frequencies. Chi-squared test statistics are formed in blocks to measure departures from the null hypothesis and the corresponding p-values are displayed in a graphic and returned invisibly. Details are in Hinich, M. and Wolinsky, M. (2005). Normalizing bispectra. Journal of Statistical Planning and Inference, 130, 405–411.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples

test.linear(nyse)  # :(
test.linear(soi)   # :)

Convert eXtensible Time Series Dates to Decimal Dates

Description

Takes an 'xts' data file, extracts the dates and converts them to decimal dates without having to have the 'xts' package loaded.

Usage

timex(xts.object)

Arguments

xts.object

an 'xts' data object

Details

For a data file made using the 'xts' package, this will produce a vector of decimal dates corresponding to the date of each observation even if 'xts' is not loaded. The script is a converter from 'unix time stamp' to decimal dates. For example, the unix time stamp of 2016-04-20 at 00:00:00 UTC is 1461110400. This will be converted to 2016.301 because 2016 was a leap year and April 20 is day 110 of the year using zero-based indexing (Jan 1 is day 0). Thus its decimal date is 2016 + (110/366).

The input object must be an 'xts' object. Note that if dog is an 'xts' data file with columns of time series, dog[,2] is NOT unless 'xts' is loaded. Thus, t <- timex(dog) will work but t <- timex(dog[,2]) may not.

Value

A vector of decimal dates is returned invisibly.

Note

We recommend the installation of 'xts' if you are working with time series, but we wanted to have an "option out" in the off chance that it can't (or won't) be installed.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Examples


tsplot(timex(lap.xts), lap.xts[,'Cmort'], col=4, ylab=NA, gg=TRUE)
title('Daily Cardiovascular Mortality')

DJIA = ts(djia[,'Close'])  
x    = cbind(DJIA, Return = diff(log(DJIA)))
tsplot(timex(djia), x, col=5, main="What, Me Worry?")


Estimate Trend

Description

Estimates the trend (polynomial or lowess) of a time series and returns a graphic of the series with the trend and error bounds (returned invisibly) superimposed.

Usage

trend(series, order = 1, lowess = FALSE, lowspan = .75, robust = TRUE,
         col = c(4, 6), ylab = NULL, ci = TRUE, results = FALSE, ...)

Arguments

series

The time series to be analyzed (univariate only).

order

Order of the polynomial used to estimate the trend with a linear default (order=1) unless lowess is TRUE.

lowess

If TRUE, loess from the stats package is used to fit the trend. The default is FALSE.

lowspan

The smoother span used for lowess.

robust

If TRUE (default), the lowess fit is robust.

col

Vector of two colors for the graphic, first the color of the data (default is blue [4]) and second the color of the trend (default is magenta [6]). Both the data and trend line will be the same color if only one value is given.

ylab

Label for the vertical axis (default is the name of the series).

ci

If TRUE (default), pointwise 95% confidence intervals are drawn.

results

For polynomial regression, if TRUE, will print a summary (using ttable) of the regression results.

...

Other graphical parameters.

Details

Produces a graphic of the time series with the trend and a .95 pointwise confidence interval superimposed. The trend estimate and the error bounds are returned invisibly.

Value

Produces a graphic and returns the trend estimate fit and error bounds lwr and upr invisibly (see details) and with the same time series attributes as the input series.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

detrend

Examples


par(mfrow=2:1)
trend(soi, results=TRUE)
trend(soi, lowess=TRUE, gg=TRUE)


Scatterplot Matrix for Time Series

Description

Produces a matrix of scatterplots with the time series (or a histogram) plotted on the diagonal.

Usage

tspairs(x, main = NA, pt.col = astsa.col(4, 0.6), pt.size = 1.1, lab.size = 1.25, 
        title.size = 1.5, scale = 1, corr = TRUE, smooth = TRUE, lwl = 1, lwc = 2, 
        gg = FALSE, hist.diag = TRUE, col.diag = 4, location='topright', ...)

Arguments

x

multiple time series; use ts.intersect to include lagged values.

main

title (default is no title).

pt.col

point color.

pt.size

point size.

lab.size

label size.

title.size

title size.

scale

multiplier for the overall character expansion (cex).

corr

if TRUE (default), the correlations are shown in the scatterplots.

smooth

if TRUE (default), a lowess fit is displayed in the scatterplots.

lwl

width of the lowess line.

lwc

color of the lowess line.

gg

if TRUE, will produce a gris-gris plot (gray graphic interior with white grid lines); the default is FALSE. The grammar of astsa is voodoo.

hist.diag

if TRUE (default), will plot histograms on the diagonal; if FALSE, time plots of the series are displayed instead.

col.diag

color for the diagonal plots.

location

the location of the ACF legend with options "bottomright", "bottom", "bottomleft", "left", "topleft", "top", "topright" (the default), "right" and "center".

...

additional graphic parameters.

Value

Returns a matrix of scatterplots with time plots or histograms on the diagonal.

Note

Use lag1.plot and lag2.plot for lag plots. But if some lagged variables are included, use ts.intersect. If there are no lagged variables, cbind will work to combine individual series.

Author(s)

D.S. Stoffer

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lag1.plot, lag2.plot

Examples


tspairs(diff(log(econ5))[,1:3], col.diag=6, hist=FALSE, pt.size=1.5, lwl=2, gg=TRUE)

tspairs(ts.intersect(MEI, MEI2), location='top')

Time Series Plot

Description

Produces a nice plot of univariate or multiple time series in one easy line.

Usage

tsplot(x, y=NULL, main=NULL, ylab=NULL, xlab=NULL, title=NULL, type=NULL, margins=.25, 
        omargins=0, ncolm=1, byrow=TRUE, nx=NULL, ny=nx, minor=TRUE, nxm=2, nym=1, 
        xm.grid=TRUE, ym.grid=TRUE, col=1, gg=FALSE, spaghetti=FALSE, pch=NULL, lty=1, 
        lwd=1, mgpp=0, topper=NULL, addLegend=FALSE, location='topright', boxit=TRUE, 
        horiz=FALSE, legend=NULL, llwd=NULL, scale=1, reset.par = TRUE, ...)

Arguments

x, y

time series to be plotted; if both present, x will be the time index.

main

add a main title - the default is no title.

ylab

y-axis label - the default is the name of the ts object.

xlab

x-axis label - the default is 'Time'.

title

add an individual plot title for multiple plots - the default is no title.

type

type of plot - the default is line.

margins

inches to add (or subtract) to the margins. Input one value to apply to all margins or a vector of length 4 to add (or subtract) to the (bottom, left, top, right) margins.

omargins

inches to add to the outer margins. Input one value to apply to all margins or a vector of length 4 to add to the (bottom, left, top, right) outer margins.

ncolm

for multiple time series, the number of columns to plot.

byrow

for multiple time series - if TRUE (default), plot series row wise; if FALSE, plot series column wise.

nx, ny

number of major cells of the grid in x and y direction. When NULL, as per default, the grid aligns with the tick marks on the corresponding default axis (i.e., tickmarks as computed by axTicks). When NA, no grid lines are drawn in the corresponding direction.

minor, nxm, nym

if minor=TRUE, the number of minor tick marks on x-axis, y-axis. minor=FALSE removes both or set either to 0 or 1 to remove. The default is one minor tick on the x-axis and none on the y-axis.

xm.grid, ym.grid

if TRUE (default), adds grid lines at minor x-axis, y-axis ticks.

col

line color(s), can be a vector for multiple time series.

gg

if TRUE, will produce a gris-gris plot (gray graphic interior with white grid lines); the default is FALSE. The grammar of astsa is voodoo; see
https://www.youtube.com/watch?v=b4J8VrprrGE

spaghetti

if TRUE, will produce a spaghetti plot (all series on same plot).

pch

plot symbols (default is 1, circle); can be a vector for multiple plots.

lty

line type (default is 1, solid line); can be a vector for multiple plots.

lwd

line width (default is 1); can be a vector for multiple plots.

mgpp

this is used to adjust (add to) the mgp graphics parameters settings (?par), which are c(1.6,.6,0) here; the R default is c(3,1,0). This will be helpful in moving an axis label farther from the axis if necessary.

topper

non-negative value to add to the top outer margin; if NULL (default) a suitable value is chosen

addLegend

if TRUE and spaghetti=TRUE, will add a simple legend. If more details are needed, leave this set to FALSE (the default) and use legend directly.

location

if addLegend=TRUE, the location of the legend with options "bottomright", "bottom", "bottomleft", "left", "topleft", "top", "topright" (the default), "right" and "center".

boxit

if TRUE (default), the legend is in a box; if FALSE, no box is drawn.

horiz

if addLegend=TRUE, should the legend be horizontal (default is FALSE - vertical).

legend

if NULL (default), the legend uses names of each time series; otherwise, use to customize legend.

llwd

line width for the legend if different from the plotted lines.

scale

for multiple series, the scale for character expansion.

reset.par

logical; for multiple series, should the graphics parameters be reset after plotting.

...

other graphical parameters; see par.

Value

Produces a graphic and returns it invisibly so it can be saved in an R variable with the ability to replay it; see recordPlot.

Note

A legend can be added using addLegend=TRUE for spaghetti plots only. Spaghetti plots work if spaghetti=TRUE and there is more than one series being plotted.

For multiple series, the default for reset.par is TRUE so that the graphic parameters are reset at the end. For example, if there are 5 plots and ncol = 2, the layout will be 3 rows, 2 columns, with an empty spot where a 6th plot would be. If you want to add something in the empty space, set this to FALSE, otherwise the graphic parameters are reset and the graphic is finished.

The scale setting is to make sure that axis labels do not get too small for large multifigure plots. While small text can be decent on a screen, it can be too small for publication. The default setting is scale=1 with larger/smaller values giving larger/smaller text.

Author(s)

D.S. Stoffer

Source

This is simply base-R plotting of time series with some bells and whistles, and written so that a nice plot can be used in demonstrations (in class or otherwise) with minimal keystrokes.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

lag1.plot, lag2.plot, tspairs,
timex for plotting xts data files when xts is not loaded

Examples

## Not run: 

# minimal
tsplot(soi)

# gris-gris spaghetti
tsplot(cbind(MEI, MEI2), spaghetti=TRUE, col=2*2:1, addLegend=TRUE, nym=2, gg=TRUE)

# gris-gris multiple plot 
tsplot(diff(log(econ5)), ncolm=2, gg=TRUE, col=2:6, lwd=2, main='Growth Rates')  

# plotting is row-wise unless byrow=FALSE is included
tsplot(climhyd, ncolm=2, gg=TRUE, col=2:7, lwd=2, xlab=c(rep(NA,4), rep('Time',2)), 
        scale=.85, ylab=NA, title=colnames(climhyd), las=1)

# missing data - try this with ggplot
tsplot(blood, type='o', col=c(4,6,3), pch=19, scale=.95, gg=TRUE,
       title = colnames(blood),  xlab  = c(NA, NA,'day'),
       ylab  = c( 'log(cells/\u03BCL)', 'log(\u03BCL)', '\u0025 red blood cells' ))


## End(Not run)

t-table summary for an lm object

Description

Works like summary for an lm object but adds AIC, AICc, and BIC to the output with the option to display VIFs.

Usage

ttable(obj, digits = 4, vif = FALSE, ...)

Arguments

obj

an object of class "lm" as a result of a call to lm.

digits

the (approximate) number of significant digits to use when printing.

vif

if TRUE, variance inflation factors are printed if applicable; default is FALSE.

...

further arguments passed to or from other methods.

Details

Produces a t-table for an lm object much like print.summary.lm with added information including AIC, AICc, BIC, and VIF (if requested and if applicable), to the output. The output is rounded and there are no significance stars. In fact, there are no stars at all.

TO REPEAT THE WARNING ON USING 'lm' FOR TIME SERIES: Considerable care must be taken:

Value

Prints a typical t-table with additional information as mentioned in the details. The p-values are two-sided. Also silently returns the same values as described in summary.lm.

Author(s)

D.S. Stoffer

Source

Built using print.summary.lm from the 'stats' package.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

summary.lm, print.summary.lm, lm

Examples


fit1 = lm(cmort~ time(cmort) + tempr + I(tempr^2))
ttable(fit1, vif=TRUE)
# if you center `tempr`, the squared term doesn't change
temp = tempr - mean(tempr)
fit2 = lm(cmort~ time(cmort) + temp + I(temp^2)) 
ttable(fit2, vif=TRUE)


U.S. Unemployment

Description

Monthly U.S. Unemployment series (1948-1978, n = 372)

Usage

data(unemp)

Format

The format is: Time-Series [1:372] from 1948 to 1979: 235 281 265 241 201 ...

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

See Also

UnempRate


Annual Varve Series

Description

Sedimentary deposits from one location in Massachusetts for 634 years, beginning nearly 12,000 years ago.

Format

The format is: Time-Series [1:634] from 1 to 634: 26.3 27.4 42.3 58.3 20.6 ...

Source

Antevs, E. (1928). The Last Glaciation with Special Reference to the Ice Retreat in Northeastern North America. Amer. Geog. Soc. Res. Series, No. 17, 292p.

Shumway and Verosub (1992). State space modeling of paleoclimatic time series. Proceedings of the 5th International Meeting on Statistical Climatology, June, 1992, University of Toronto, 139p.

References

You can find demonstrations of astsa capabilities at FUN WITH ASTSA.

The most recent version of the package can be found at https://github.com/nickpoison/astsa/.

In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.

The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.

Need mirroring services?
Contact our team at info@vpspulse.com.

Mirror powered by VPSpulse

Infrastructure sponsored by VPSPulse & Secure Payments by ArionPay.