VPSPulse Mirrors

High-Performance Open-Source Archive

Tutorial

Tutorial

library(ace2fastq)

Introduction

The package provides a function that converts “.ace” files (ABI Sanger capillary sequence assembly files) to standard “.fastq” files. The file format is currently used in genomics to store contigs. To the best of our knowledge, no R function is available to convert this format into the more popular fastq file format. Each file may contain one or more contig sequences and corresponding quality values.

The function expects as a minimum a full path to the .ace file. By default a corresponding file with .fastq extension instead of .ace will be created. Also by default, the id line in the fastq file start after the obligatory @ with the name of the original .ace file without the extension followed by the internal original id from the .ace file.

A default example follows:

library(ace2fastq)

filename <- system.file("sampledat/1.seq.ace", package = "ace2fastq")

out_file <- ace_to_fastq(filename, target_dir = tempdir())

lines <- readLines(out_file$path)

length(lines)
#> [1] 4
#> [1] "@1.seq CO Contig1 1475 8 156 U"
#> [1] "cgcttaaaccttccaagtctgaaacgggaaatttgatttgc"
#> [1] "+"
#> [1] "!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!"

A example with the alternative id pattern follows:

library(ace2fastq)

filename <- system.file("sampledat/1.seq.ace", package = "ace2fastq")

out_file <- ace_to_fastq(filename = filename, target_dir = tempdir(), name2id = FALSE)

lines <- readLines(out_file$path)
#> [1] "@CO Contig1 1475 8 156 U"

The target directory path can also be changed.

Multiple contig sequences

A default example follows with three contigs resulting in four lines:

Need mirroring services?
Contact our team at info@vpspulse.com.

Mirror powered by VPSpulse

Infrastructure sponsored by VPSPulse & Secure Payments by ArionPay.